Bactrocera dorsalis

From ICG
Revision as of 11:58, 16 June 2017 by Xysj2012 (talk | contribs) (Created page with "=='''Description'''== =='''''Different Tissues'''''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene Name !...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Description

Different Tissues

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
α-TUB[1] alpha tubulin
  • female flies
  • males files
  • fat body
GU269902
  • F:CGCATTCATGGTTGATAACG
  • R:GGGCACCAAGTTAGTCTGGA
184 60 SYBR
ACT3[1] clone BdA3
  • males files
L12255
  • F:GGTCGGTATGGGACAGAAGG
  • R: CTCACGATTGGCTTTTGGAT
220 60 SYBR
ACT5[1] clone BdA5
  • female flies
L12256
  • F:CAACTCACCCGCAATGTATG
  • R:CGCTCAGCAGTGGTTGTAAA
237 60 SYBR
ACT1[1] clone BdA1
  • fat body
L12253
  • F:AGCGTGAAATCGTGAGGGA
  • R:GACAAGACCGAGTTGGCATA
286 60 SYBR
ACT2 [1] clone BdA2
  • both males and females
L12254
  • F:GTGTGATGGTTGGTATGGGA
  • R:GGCTGGGGAGTTGAAGGTTT
269 60 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Jin-Jun Wang
  • Email: jjwang7008@yahoo.com
  • Institution: Key Laboratory of Entomology and Pest Control Engineering, College of Plant Protection, Southwest University, Chongqing 400715, P. R. China

References

  1. 1.0 1.1 1.2 1.3 1.4 Shen G M, Jiang H B, Wang X N, et al. Evaluation of endogenous references for gene expression profiling in different tissues of the oriental fruit fly Bactrocera dorsalis (Diptera: Tephritidae)[J]. BMC molecular biology, 2010, 11(1): 76.