Difference between revisions of "Balanus amphitrite"

From ICG
Jump to navigation Jump to search
Line 4: Line 4:
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
! Gene symbol  
+
! Gene Symbol  
! Gene name
+
! Gene Name
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
Line 38: Line 38:
 
|}
 
|}
  
===Moleculer types===
+
===Moleculer Types===
 
* mRNA
 
* mRNA
  
Line 50: Line 50:
 
*'''Email''':  t.bacchetti-de-gregoris@ncl.ac.uk
 
*'''Email''':  t.bacchetti-de-gregoris@ncl.ac.uk
 
*'''Institute''':  School of Marine Science and Technology, Ridley Building, Newcastle University, Newcastle upon Tyne, NE1 7RU, England, UK
 
*'''Institute''':  School of Marine Science and Technology, Ridley Building, Newcastle University, Newcastle upon Tyne, NE1 7RU, England, UK
 +
===Citation Statistics===
 +
Cited by '''32''' (Based on Google Scholar [2017-06-16])
  
 
=='''References'''==
 
=='''References'''==

Revision as of 10:28, 16 June 2017

Description

Different Developmental Stages

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
mt-cyb[1] cytochrome b
  • developmental stages
FM882286
  • F:GGACACTGCATGCTAATGGA
  • R:AGGCAGCAGCCATAGTCAAG
144 60 SYBR
mt-nd1[1] NADH dehydrogenase subunit 1
  • developmental stages
FM882393
  • F:CGGGCTGTTGCTCAAACTA
  • R:TTCGACAAAATCTTCCAATCT
102 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Tristano Bacchetti De Gregoris
  • Email: t.bacchetti-de-gregoris@ncl.ac.uk
  • Institute: School of Marine Science and Technology, Ridley Building, Newcastle University, Newcastle upon Tyne, NE1 7RU, England, UK

Citation Statistics

Cited by 32 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 De Gregoris T B, Borra M, Biffali E, et al. Construction of an adult barnacle (Balanus amphitrite) cDNA library and selection of reference genes for quantitative RT-PCR studies[J]. BMC molecular biology, 2009, 10(1): 62.