Balanus amphitrite

From ICG
Jump to navigation Jump to search

Description

REFqPCRBalanus amphitrite.jpg
  • The barnacle Balanus amphitrite is a sessile gregarious species that is a model organism for both fundamental and applied larval settlement studies due to its invasive behaviour, its worldwide distribution, and the relative simplicity of manipulating its reproduction in the laboratory.
  • The life cycle of B. amphitrite is characterized by the presence of six planktonic naupliar stages (naupliar instar I-VI) followed by a non-feeding larval stage, the cyprid, that is specialized to explore the substratum in order to locate a suitable place for permanent attachment.
  • A number of behavioural studies have shown that B. amphitrite cyprids respond to biotic and abiotic factors as they explore the substratum. To date however, the paucity of genomic information available for this organism has hindered in-depth mechanistic studies of the surface colonization process.

Different Developmental Stages

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
mt-cyb[1][2] cytochrome b
  • Developmental stages
FM882286
  • F:GGACACTGCATGCTAATGGA
  • R:AGGCAGCAGCCATAGTCAAG
144 60 SYBR
mt-nd1[1] NADH dehydrogenase subunit 1
  • Developmental stages
FM882393
  • F:CGGGCTGTTGCTCAAACTA
  • R:TTCGACAAAATCTTCCAATCT
102 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Tristano Bacchetti De Gregoris
  • Email: t.bacchetti-de-gregoris@ncl.ac.uk
  • Institute: School of Marine Science and Technology, Ridley Building, Newcastle University, Newcastle upon Tyne, NE1 7RU, England, UK

Citation Statistics

Cited by 32 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 De Gregoris T B, Borra M, Biffali E, et al. Construction of an adult barnacle (Balanus amphitrite) cDNA library and selection of reference genes for quantitative RT-PCR studies[J]. BMC molecular biology, 2009, 10(1): 62.
  2. Tristano Bacchetti De Gregoris, Marco Borra, Elio Biffali, Thomas Bekel, J Grant Burgess, Richard R Kirby and Anthony S Clare. Construction of an adult barnacle (Balanus amphitrite) cDNA library and selection of reference genes for quantitative RT-PCR studies. Bacchetti De Gregoris et al; licensee BioMed Central Ltd. 2009 Received: 12 December 2008. BMC Molecular Biology200910:62 DOI: 10.1186/1471-2199-10-62.