Balanus amphitrite

From ICG
Jump to navigation Jump to search

Description

Different Developmental Stages

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
mt-cyb[1] cytochrome b
  • developmental stages
FM882286
  • F:GGACACTGCATGCTAATGGA
  • R:AGGCAGCAGCCATAGTCAAG
144 60 SYBR
mt-nd1[1] NADH dehydrogenase subunit 1
  • developmental stages
FM882393
  • F:CGGGCTGTTGCTCAAACTA
  • R:TTCGACAAAATCTTCCAATCT
102 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Tristano Bacchetti De Gregoris
  • Email: t.bacchetti-de-gregoris@ncl.ac.uk
  • Institute: School of Marine Science and Technology, Ridley Building, Newcastle University, Newcastle upon Tyne, NE1 7RU, England, UK

Citation Statistics

Cited by 32 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 De Gregoris T B, Borra M, Biffali E, et al. Construction of an adult barnacle (Balanus amphitrite) cDNA library and selection of reference genes for quantitative RT-PCR studies[J]. BMC molecular biology, 2009, 10(1): 62.