Bemisia tabaci

From ICG
Revision as of 07:14, 16 June 2017 by ICG Expert4 (talk | contribs) (Created page with "==Description== right|327px| * Bemisia tabaci has long been considered a complex species. It rose to global prominence in the 1980s owing to the...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Description

REFqPCR2014017-1.jpg
  • Bemisia tabaci has long been considered a complex species. It rose to global prominence in the 1980s owing to the global invasion by the commonly named B biotype. Since then, the concomitant eruption of a group of plant viruses known as begomoviruses has created considerable management problems in many countries.
  • B. tabaci is a complex of 11 well-defined high-level groups containing at least 24 morphologically indistinguishable species. Bemisia tabaci (Gennadius) (Insecta: Hemiptera: Homoptera: Sternorrhyncha: Aleyrodoidea: Aleyrodidae: Aleyrodinae) is a phloem-feeding insect that lives predominantly on herbaceous species.
  • It is a considerable pest of ornamental, vegetable, grain legume, and cotton production, causing damage directly through feeding and indirectly through the transmission of plant pathogenic viruses, primarily begomoviruses. It has a global distribution. [1] [2].

Different Commercially Available Insecticides

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
EF1a[1] elongation factor1-alpha
  • Different insecticide treatments
EE600682
  • F:GATGGCACGGAGACAATATG
  • R:TTGTCAGTGGGTCTGCTAGG
138 60 SYBR
TUB1a[1] Tubulin alpha-1 chain
  • Different insecticide treatments
EE598061
  • F:CACTGTTGTTCCTGGTGGC
  • R:AGTGGACGAAAGCACGCTTG
140 60 SYBR
GAPDH[1] glyceraldehyde-3-phosphate dehydrogenase
  • Different insecticide treatments
JU470454
  • F:AAATGACTTTCCCTACAGC
  • R:ATTATGGCGTGATGGC
82 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xiwu Gao
  • Email: gaoxiwu@263.net.cn
  • Institution: Department of Entomology, China Agricultural University, Beijing, P. R. China

References

  1. 1.0 1.1 1.2 1.3 Liang P, Guo Y, Zhou X, Gao X (2014) Expression profiling in Bemisia tabaci under insecticide treatment: indicating the necessity for custom reference gene selection. PLoS One 9, e87514
  2. De Barro PJ, Liu SS, Boykin LM, Dinsdale AB (2011) Bemisia tabaci: A Statement of Species Status. Annual Review of Entomology, Vol 56 56, 1-19.