Difference between revisions of "Bos indicus"

From ICG
Jump to navigation Jump to search
 
(12 intermediate revisions by 3 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
+
[[File:Bos indicus.png|right|200px|link=Bos indicus]]
[[File:Bos indicus-1.png|right|327px|]]
+
* '''''Bos indicus''''' are the most common type of large domesticated ungulates. They are a prominent modern member of the subfamily Bovinae, are the most widespread species of the genus Bos. They are characterised by a fatty hump on their shoulders, a large dewlap, and sometimes drooping ears. They are well adapted to withstanding high temperatures, and are farmed throughout the tropical countries. They are raised as livestock for meat (beef and veal), as dairy animals for milk and other dairy products. Other products include leather and dung for manure or fuel<ref name="ref1"/><ref name="ref2"/>.
* Cow are the most common type of large domesticated ungulates. They are a prominent modern member of the subfamily Bovinae, are the most widespread species of the genus Bos, and are most commonly classified collectively as Bos taurus. Cattle are raised as livestock for meat (beef and veal), as dairy animals for milk and other dairy products, and as draft animals (oxen or bullocks that pull carts, plows and other implements). Other products include leather and dung for manure or fuel. In some regions, such as parts of India, cattle have significant religious meaning. Around 10,500 years ago, cattle were domesticated from as few as 80 progenitors in southeast Turkey<ref name="ref1"/> <ref name="ref2"/>.
+
* <font color=blue>'''Common Name:'''</font> '''Zebu''', '''Zebu cattle'''
* <font color=blue>'''Common Name:'''</font> '''Zebu'''
 
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9915 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9915 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Milk Somatic Cells'''''==
 
=='''''Milk Somatic Cells'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 22: Line 21:
 
|align="center"| Protein phosphatase 1 regulatory subunit 11
 
|align="center"| Protein phosphatase 1 regulatory subunit 11
 
|
 
|
* Universal reference gene
+
* Milk somatic cells
 +
* Multiparous lactating Sahiwal cows
 +
* Different lactation stages
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001100295 '''NM_001100295''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001100295 '''NM_001100295''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 34: Line 35:
 
|align="center"| β-actin
 
|align="center"| β-actin
 
|
 
|
* Universal reference gene
+
* Milk somatic cells
 +
* Multiparous lactating Sahiwal cows
 +
* Different lactation stages
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_173979 '''NM_173979''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_173979 '''NM_173979''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 46: Line 49:
 
|align="center"| Ubiquitin
 
|align="center"| Ubiquitin
 
|
 
|
* Universal reference gene
+
* Milk somatic cells
 +
* Multiparous lactating Sahiwal cows
 +
* Different lactation stages
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/Z18245 '''Z18245''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/Z18245 '''Z18245''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 58: Line 63:
 
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 
|align="center"| Glyceraldehyde-3-phosphate dehydrogenase
 
|
 
|
* Universal reference gene
+
* Milk somatic cells
 +
* Multiparous lactating Sahiwal cows
 +
* Different lactation stages
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001034034.1 '''NM_001034034.1''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001034034.1 '''NM_001034034.1''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 80: Line 87:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''15''' (Based on Google Scholar [2017-06-23])
+
Cited by [https://scholar.google.com/scholar?cites=5054632321531940978&as_sdt=2005&sciodt=0,5&hl=en '''15'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 91: Line 98:
 
</ref>
 
</ref>
 
</references>
 
</references>
 
+
=='''Categories'''==
 
[[Category:Animals]]
 
[[Category:Animals]]
 
[[Category:mRNA]]
 
[[Category:mRNA]]
Line 97: Line 104:
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 
[[Category:ACT]] [[Category:GAPDH]] [[Category:PPP1R11]] [[Category:Ubiquitin]][[Category:Specific Cells]]
 
[[Category:ACT]] [[Category:GAPDH]] [[Category:PPP1R11]] [[Category:Ubiquitin]][[Category:Specific Cells]]
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]

Latest revision as of 06:34, 1 September 2017

Description

Bos indicus.png
  • Bos indicus are the most common type of large domesticated ungulates. They are a prominent modern member of the subfamily Bovinae, are the most widespread species of the genus Bos. They are characterised by a fatty hump on their shoulders, a large dewlap, and sometimes drooping ears. They are well adapted to withstanding high temperatures, and are farmed throughout the tropical countries. They are raised as livestock for meat (beef and veal), as dairy animals for milk and other dairy products. Other products include leather and dung for manure or fuel[1][2].
  • Common Name: Zebu, Zebu cattle
  • NCBI Taxonomy

Milk Somatic Cells

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
PPP1R11[1] Protein phosphatase 1 regulatory subunit 11
  • Milk somatic cells
  • Multiparous lactating Sahiwal cows
  • Different lactation stages
NM_001100295
  • F:ACCATCAAACTTCGGAAACG
  • R:CCTCCTCTTCCTCGTCATCA
NA 60 SYBR
ACTB[1] β-actin
  • Milk somatic cells
  • Multiparous lactating Sahiwal cows
  • Different lactation stages
NM_173979
  • F:CTCTTCCAGCCTTCCTTCCT
  • R:GGGCAGTGATCTCTTTCTGC
NA 63 SYBR
UBC[1] Ubiquitin
  • Milk somatic cells
  • Multiparous lactating Sahiwal cows
  • Different lactation stages
Z18245
  • F:AGATCCAGGATAAGGAAGGCAT
  • R:GCTCCACCTCCAGGGTGAT
NA 60 SYBR
GAPDH[1] Glyceraldehyde-3-phosphate dehydrogenase
  • Milk somatic cells
  • Multiparous lactating Sahiwal cows
  • Different lactation stages
NM_001034034.1
  • F:GGGTCATCATCTCTGCACCT
  • R:GGTCATAAGTCCCTCCACGA
NA 62 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Mohanty
  • Email: ashokmohanty1@gmail.com
  • Institution: ational Dairy Research Institute, Karnal 132001, India

Citation Statistics

Cited by 15 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Varshney N, Mohanty A K, Kumar S, et al. Selection of suitable reference genes for quantitative gene expression studies in milk somatic cells of lactating cows (Bos indicus)[J]. Journal of dairy science, 2012, 95(6): 2935-2945.
  2. N. Varshney, A. K. Mohanty , S. Kumar , J. K. Kaushik, A. K. Dang ,M. Mukesh , B. P. Mishra , R. Kataria , S. P. Kimothi ,T. K. Mukhopadhyay , D. Malakar , B. S. Prakash , S. Grover , and V. K. Batish. Selection of suitable reference genes for quantitative gene expression studies in milk somatic cells of lactating cows (Bos indicus). J. Dairy Sci. 95 :2935–2945 http://dx.doi.org/ 10.3168/jds.2011-4442.

Categories