Bos indicus

From ICG
Jump to navigation Jump to search

Description

Bos indicus-1.png
  • Cow are the most common type of large domesticated ungulates. They are a prominent modern member of the subfamily Bovinae, are the most widespread species of the genus Bos, and are most commonly classified collectively as Bos taurus. Cattle are raised as livestock for meat (beef and veal), as dairy animals for milk and other dairy products, and as draft animals (oxen or bullocks that pull carts, plows and other implements). Other products include leather and dung for manure or fuel. In some regions, such as parts of India, cattle have significant religious meaning. Around 10,500 years ago, cattle were domesticated from as few as 80 progenitors in southeast Turkey[1] [2].

Milk Somatic Cells

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
PPP1R11[1] protein phosphatase 1 regulatory subunit 11
  • Universal reference gene
NM_001100295
  • F:ACCATCAAACTTCGGAAACG
  • R:CCTCCTCTTCCTCGTCATCA
NA 60 SYBR
ACTB[1] β-actin
  • Universal reference gene
NM_173979
  • F:CTCTTCCAGCCTTCCTTCCT
  • R:GGGCAGTGATCTCTTTCTGC
NA 63 SYBR
UBC[1] ubiquitin
  • Universal reference gene
Z18245
  • F:AGATCCAGGATAAGGAAGGCAT
  • R:GCTCCACCTCCAGGGTGAT
NA 60 SYBR
GAPDH[1] glyceraldehyde-3-phosphate dehydrogenase
  • Universal reference gene
NM_001034034.1
  • F:GGGTCATCATCTCTGCACCT
  • R:GGTCATAAGTCCCTCCACGA
NA 62 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Mohanty
  • Email: ashokmohanty1@gmail.com
  • Institution: ational Dairy Research Institute, Karnal 132001, India

Citation Statistics

Cited by 14 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Varshney N, Mohanty A K, Kumar S, et al. Selection of suitable reference genes for quantitative gene expression studies in milk somatic cells of lactating cows (Bos indicus)[J]. Journal of dairy science, 2012, 95(6): 2935-2945.
  2. N. Varshney, A. K. Mohanty , S. Kumar , J. K. Kaushik, A. K. Dang ,M. Mukesh , B. P. Mishra , R. Kataria , S. P. Kimothi ,T. K. Mukhopadhyay , D. Malakar , B. S. Prakash , S. Grover , and V. K. Batish. Selection of suitable reference genes for quantitative gene expression studies in milk somatic cells of lactating cows (Bos indicus). J. Dairy Sci. 95 :2935–2945 http://dx.doi.org/ 10.3168/jds.2011-4442.