Difference between revisions of "Bos taurus"

From ICG
Jump to navigation Jump to search
Line 81: Line 81:
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 
[[Category:RPL]] [[Category:TBP]] [[Category:Ubiquitin]]
 
[[Category:RPL]] [[Category:TBP]] [[Category:Ubiquitin]]
 +
[[Category:Biotic Stress]]  [[Category:Viral Infection]]  [[Category:Pathological conditions]]

Revision as of 15:07, 21 June 2017

Description

Bos taurus.jpg
  • Cattle—colloquially cows—are the most common type of large domesticated ungulates. They are a prominent modern member of the subfamily Bovinae, are the most widespread species of the genus Bos, and are most commonly classified collectively as Bos taurus.
  • Cattle are raised as livestock for meat (beef and veal), as dairy animals for milk and other dairy products, and as draft animals (oxen or bullocks that pull carts, plows and other implements). Other products include leather and dung for manure or fuel. In some regions, such as parts of India, cattle have significant religious meaning. Around 10,500 years ago, cattle were domesticated from as few as 80 progenitors in southeast Turkey.
  • The time budget of dairy cows can be affected by housing system and management. In systems with automatic milking, the amount of time cows have to spend in the waiting area in front of the robot depends on the cow's position in the social hierarchy (Ketelaar de Lauwere et al., 1996)[1][2].

Viral Infection

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
UCHL5[1] Ubiquitin carboxyl-terminal hydrolase L5
  • Leukemia-virus infected
NM_174481
  • F:ACAAAGACAACTTGCTGAGGAACCC
  • R:GGCAACCTCTGACTGAATAGCACTT
79 60 SYBR
RPLP0[1] Ribosomal protein large P0
  • Leukemia-virus infected
NM_001012682
  • F:CAACCCTGAAGTGCTTGACAT
  • R:AGGCAGATGGATCAGCCA
227 58 SYBR
TBP[1] TATA box binding protein
  • Leukemia-virus infected
NM_001075742
  • F:ACAGCCTCCCACCCTATGCCC
  • R:GCTGTGGAGTCAGTCCTGTGCC
111 58 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: P. Brym
  • Email: pawbrym@uwm.edu.pl
  • Institution: Department of Animal Genetics, University of Warmia and Mazury in Olsztyn, Oczapowskiego 5, 10-719 Olsztyn, Poland

Citation Statistics

Cited by 8 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 Brym P, Ruść A, Kamiński S. Evaluation of reference genes for qRT-PCR gene expression studies in whole blood samples from healthy and leukemia-virus infected cattle[J]. Veterinary immunology and immunopathology, 2013, 153(3): 302-307.
  2. Lene Munksgaard, Margit B. Jensen, Lene J. Pedersen, Steffen W. Hansen, Lindsay Matthews, Quantifying behavioural priorities—effects of time constraints on behaviour of dairy cows, , Applied Animal Behaviour Science, Volume 92, Issue 1, 2005, Pages 3-14, ISSN 0168-1591.