Brachiaria brizantha

From ICG
Jump to navigation Jump to search

Description

Brachiaria brizantha.png
  • Brachiaria brizantha is an important forage grass. The occurrence of both apomictic and sexual reproduction within Brachiaria makes it an interesting system for understanding the molecular pathways involved in both modes of reproduction.[1]
  • Common Name: Palisade grass
  • NCBI Taxonomy

Different Sex & Tissues

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
BbrizEF1[1] Elongation factor-1 alpha
  • Male and female reproductive tissues
  • Spikelets & roots & leaves
  • Ovary tissues
EZ000623
  • F:ACCCTCCTCTTGGTCGTTTT
  • R:AGCCCCTCATTTCTTCTTGG
105 60 SYBR
BbrizUBCE[1] Ubiquitin-conjugating enzyme
  • Ovary tissues
GE617481
  • F:GGTCTTGCTCTCCATCTGCT
  • R:CGGGCTGTCGTCTCATACTT
114 60 SYBR
BbrizE1F4A[1] Eukaryotic initiation factor 4A
  • Ovary tissues
EZ000622
  • F:TAAGGTGGGGCTTGTTTTTG
  • R:ACAGCAGCACATACCACAGG3
164 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Vera Tavares de Campos Carneiro
  • Email: vera@cenargen.embrapa.br
  • Institution: Embrapa Genetic Resources and Biotechnology, Parque Estação Biológica, PqEB Av. W5 Norte (final) Caixa Postal 02372, Brasília, Brasil

Citation Statistics

Cited by 17 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 1.3 Koči J, Šimo L, Park Y. Validation of internal reference genes for real-time quantitative polymerase chain reaction studies in the tick, Ixodes scapularis (Acari: Ixodidae)[J]. Journal of medical entomology, 2013, 50(1): 79-84.