Brachiaria brizantha

Description

Brachiaria brizantha is an important forage grass. The occurrence of both apomictic and sexual reproduction within Brachiaria makes it an interesting system for understanding the molecular pathways involved in both modes of reproduction.^[1]
Common Name: Palisade grass
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
BbrizEF1^[1]	Elongation factor-1 alpha	Male and female reproductive tissues Spikelets & roots & leaves Ovary tissues	EZ000623	F:ACCCTCCTCTTGGTCGTTTT R:AGCCCCTCATTTCTTCTTGG	105	60	SYBR
BbrizUBCE^[1]	Ubiquitin-conjugating enzyme	Ovary tissues	GE617481	F:GGTCTTGCTCTCCATCTGCT R:CGGGCTGTCGTCTCATACTT	114	60	SYBR
BbrizE1F4A^[1]	Eukaryotic initiation factor 4A	Ovary tissues	EZ000622	F:TAAGGTGGGGCTTGTTTTTG R:ACAGCAGCACATACCACAGG3	164	60	SYBR

Name: Vera Tavares de Campos Carneiro
Email: vera@cenargen.embrapa.br
Institution: Embrapa Genetic Resources and Biotechnology, Parque Estação Biológica, PqEB Av. W5 Norte (final) Caixa Postal 02372, Brasília, Brasil

Cited by 17 (Based on Google Scholar [2017-06-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Koči J, Šimo L, Park Y. Validation of internal reference genes for real-time quantitative polymerase chain reaction studies in the tick, Ixodes scapularis (Acari: Ixodidae)[J]. Journal of medical entomology, 2013, 50(1): 79-84.