Difference between revisions of "Branchiostoma japonicum"

From ICG
Jump to navigation Jump to search
 
(9 intermediate revisions by 3 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
+
[[File:Branchiostoma japonicum.png|right|200px|link=Branchiostoma japonicum]]
[[File:Branchiostoma japonicum-1.png|right|327px|]]
+
* '''''Branchiostoma japonicum''''' is a well-known model organism widely used for interspecies comparative genome study, developmental homology analysis and comparative immunological investigation.  As a cephalochordate, it has long been considered as the extant invertebrate most closely related to the proximate invertebrate ancestor of vertebrates. It is a well-known model organism widely used for interspecies comparative genome study, developmental homology analysis and comparative immunological investigation<ref name="ref1"/>.
* Amphioxus is a well-known model organism widely used for interspecies comparative genome study, developmental homology analysis and comparative immunological investigation.  Amphioxus, a cephalochordate, has long been considered as the extant invertebrate most closely related to the proximate invertebrate ancestor of vertebrates. It is a well-known model organism widely used for interspecies comparative genome study, developmental homology analysis and comparative immunological investigation<ref name="ref1"/>.
+
* <font color=blue>'''Common Name:'''</font> '''Lancelet''', '''Japanese lancelet'''
* <font color=blue>'''Common Name:'''</font> '''Lancelet'''
 
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=373177 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=373177 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
==''''' Gene Expression Regulation Studies'''''==
 
==''''' Gene Expression Regulation Studies'''''==
===Reference Genes===
+
===Internal Control Genes===
 +
 
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 22: Line 22:
 
|align="center"| Elongation factor 1-alpha
 
|align="center"| Elongation factor 1-alpha
 
|
 
|
* Universal reference gene
+
* Whole body, gut, gut-free body, hepatic caecum, gill, hind-gut, notochord and muscle
 +
* Gut and gut-free body
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_002604678.1 '''XM_002604678.1''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/XM_002604678.1 '''XM_002604678.1''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 31: Line 32:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
 +
 
===Molecular Types===
 
===Molecular Types===
 
*mRNA
 
*mRNA
Line 45: Line 47:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''15''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=7109034888674637466&as_sdt=2005&sciodt=0,5&hl=en '''16'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 53: Line 55:
 
</ref>
 
</ref>
 
</references>
 
</references>
 
+
=='''Categories'''==
 
[[Category:Animals]]
 
[[Category:Animals]]
 
[[Category:mRNA]]
 
[[Category:mRNA]]
Line 60: Line 62:
 
[[Category:EF1α]]
 
[[Category:EF1α]]
 
[[Category:Gene Expression Regulation Studies]]
 
[[Category:Gene Expression Regulation Studies]]
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
[[Category:Delta Ct]]
 +
[[Category:RefFinder]]

Latest revision as of 06:39, 1 September 2017

Description

Branchiostoma japonicum.png
  • Branchiostoma japonicum is a well-known model organism widely used for interspecies comparative genome study, developmental homology analysis and comparative immunological investigation. As a cephalochordate, it has long been considered as the extant invertebrate most closely related to the proximate invertebrate ancestor of vertebrates. It is a well-known model organism widely used for interspecies comparative genome study, developmental homology analysis and comparative immunological investigation[1].
  • Common Name: Lancelet, Japanese lancelet
  • NCBI Taxonomy

Gene Expression Regulation Studies

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1a[1] Elongation factor 1-alpha
  • Whole body, gut, gut-free body, hepatic caecum, gill, hind-gut, notochord and muscle
  • Gut and gut-free body
XM_002604678.1
  • F:TGCTGATTGTGGCTGCTGGTACTG
  • R:GGTGTAGGCCAGCAGGGCGTG
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Shicui Zhang
  • Email: sczhang@ouc.edu.cn
  • Institution: Institute of Evolution & Marine Biodiversity, Ocean University of China, Qingdao 266003, China

Citation Statistics

Cited by 16 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 Wang Y, Zhang S. EF1α is a useful internal reference for studies of gene expression regulation in amphioxus Branchiostoma japonicum[J]. Fish & shellfish immunology, 2012, 32(6): 1068-1073.

Categories