Branchiostoma japonicum

From ICG
Jump to navigation Jump to search

Description

Branchiostoma japonicum-1.png
  • Amphioxus is a well-known model organism widely used for interspecies comparative genome study, developmental homology analysis and comparative immunological investigation. Amphioxus, a cephalochordate, has long been considered as the extant invertebrate most closely related to the proximate invertebrate ancestor of vertebrates. It is a well-known model organism widely used for interspecies comparative genome study, developmental homology analysis and comparative immunological investigation[1].

Gene Expression Regulation Studies

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1a[1] elongation factor 1-alpha
  • Universal reference gene
XM_002604678.1
  • F:TGCTGATTGTGGCTGCTGGTACTG
  • R:GGTGTAGGCCAGCAGGGCGTG
NA 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Shicui Zhang
  • Email: sczhang@ouc.edu.cn
  • Institution: Institute of Evolution & Marine Biodiversity, Ocean University of China, Qingdao 266003, China

Citation Statistics

Cited by 15 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 Wang Y, Zhang S. EF1α is a useful internal reference for studies of gene expression regulation in amphioxus Branchiostoma japonicum[J]. Fish & shellfish immunology, 2012, 32(6): 1068-1073.