Difference between revisions of "Brassica napus"

From ICG
Jump to navigation Jump to search
 
(17 intermediate revisions by 7 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
[[File:REFqPCRBrassica napus.jpg|right|227px|]]
+
[[File:Brassica napus.png|right|200px|]]
  
*Oilseed rape (Brassica napus) is one of the most agriculturally important crops in the world, because of its large oilseed production (approximately 64 million metric tons (MMT) worldwide in 2012), with China producing about 14 MMT and Canada, the European Union, India, and Australia being the other major contributors.  
+
*'''''Brassica napus''''' is one of the most agriculturally important crops in the world, because of its large oilseed production. During cultivation of oilseed rape, it will be exposed to various adverse environmental conditions, including abiotic and biotic stresses, such as drought, high-salinity, and pathogens, which result in production losses. In recent years, more and more researchers have focused on gene expression studies in this crop under various exogenous stimulations to understand its defense mechanisms.
*During cultivation of oilseed rape, it will be exposed to various adverse environmental conditions, including abiotic and biotic stresses, such as drought, high-salinity, and pathogens, which result in production losses.
+
* <font color=blue>'''Common Name:'''</font> '''Oilseed rape''','''Rapaseed'''
*For instance, yield losses in the crop as high as 24 % caused by Sclerotinia sclerotiorum have been reported in Australia. In recent years, more and more researchers have focused on gene expression studies in this crop under various exogenous stimulations to understand its defense mechanisms.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3708 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Abiotic & Biotic Stress'''''==
 
=='''''Abiotic & Biotic Stress'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 19: Line 19:
 
! Detection
 
! Detection
 
|-
 
|-
|align="center"| ACT7<ref name="ref1"/><ref name="ref2"/>
+
|align="center"| ACT7<ref name="ref1"/>
 
|align="center"| Actin7
 
|align="center"| Actin7
 
|
 
|
Line 34: Line 34:
 
|-
 
|-
 
|align="center"| SAND<ref name="ref1"/>
 
|align="center"| SAND<ref name="ref1"/>
|align="center"| SanD-family protein
+
|align="center"| SAND family protein
 
|
 
|
 
*Cold stress
 
*Cold stress
Line 115: Line 115:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 126: Line 126:
 
*'''Name''': Zheng Wang
 
*'''Name''': Zheng Wang
 
*'''Email''': xltan@ujs.edu.cn
 
*'''Email''': xltan@ujs.edu.cn
*'''Institute''': Institute of life Sciences, Jiangsu University, 301# Xuefu Road, Zhenjiang 212013, People’s Republic of china
+
*'''Institution''': Institute of life Sciences, Jiangsu University, 301# Xuefu Road, Zhenjiang 212013, People’s Republic of china
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''24''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=3000053813826201682&as_sdt=2005&sciodt=0,5&hl=en '''27'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 134: Line 135:
 
<ref name="ref1">
 
<ref name="ref1">
 
Wang Z, Chen Y, Fang H, et al. Selection of reference genes for quantitative reverse-transcription polymerase chain reaction normalization in Brassica napus under various stress conditions[J]. Molecular genetics and genomics, 2014, 289(5): 1023-1035.
 
Wang Z, Chen Y, Fang H, et al. Selection of reference genes for quantitative reverse-transcription polymerase chain reaction normalization in Brassica napus under various stress conditions[J]. Molecular genetics and genomics, 2014, 289(5): 1023-1035.
</ref>
 
<ref name="ref2">
 
Artico S, Nardeli SM, Brilhante O, Grossi-de-Sa MF, Alves-Ferreira M (2010) Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data. BMC Plant Biol 10:49
 
 
 
</ref>
 
</ref>
 
</references>
 
</references>
  
[[Category:Plants]]
+
=='''Categories'''==
[[Category:mRNA]] 
+
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]][[Category:ACT]] [[Category:F-box]] [[Category:PP2A]] [[Category:SAND]] [[Category:TIP41]] [[Category:Ubiquitin]] [[Category:ZNF]]
[[Category:SYBR]]
 
[[Category:ACT]] [[Category:F-box]] [[Category:PP2A]] [[Category:SAND]] [[Category:TIP41]] [[Category:Ubiquitin]] [[Category:ZNF]]
 
 
[[Category:Salinity Treatment]]  [[Category:Abiotic Stress]]  [[Category:Biotic Stress]]  [[Category:Hormone Treatment]]  [[Category:Heavy Metals Treatments]]  [[Category:Pathological conditions]]
 
[[Category:Salinity Treatment]]  [[Category:Abiotic Stress]]  [[Category:Biotic Stress]]  [[Category:Hormone Treatment]]  [[Category:Heavy Metals Treatments]]  [[Category:Pathological conditions]]
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]

Latest revision as of 08:00, 1 September 2017

Description

Brassica napus.png
  • Brassica napus is one of the most agriculturally important crops in the world, because of its large oilseed production. During cultivation of oilseed rape, it will be exposed to various adverse environmental conditions, including abiotic and biotic stresses, such as drought, high-salinity, and pathogens, which result in production losses. In recent years, more and more researchers have focused on gene expression studies in this crop under various exogenous stimulations to understand its defense mechanisms.
  • Common Name: Oilseed rape,Rapaseed
  • NCBI Taxonomy

Abiotic & Biotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACT7[1] Actin7
  • Heavy metal (cr 6+) stress
  • Methyl jasmonate stress
  • Abscisic acid stress
Bra028615
  • F:GCTGACCGTATGAGCAAAG
  • R:AAGATGGATGGACCCGAC
182 85.4 SYBR
SAND[1] SAND family protein
  • Cold stress
Bra000494
  • F:GCTGAAGGTGGATTGCGTG
  • R:GGAGTTTCTGGTATGCTCGGTAT
244 82.7 SYBR
UBC21[1] Ubiquitin-conjugating enzyme 21
  • Drought stress
  • Sclerotinia sclerotiorum stress
EV086936
  • F:CCTCTGCAGCCTCCTCAAGT
  • R:CATATCTCCCCTGTCTTGAAATGC
77 78.8 SYBR
PP2A[1] Protein phosphatase 2a subunit a3
  • Salt stress
  • Drought stress
  • Methyl jasmonate stress
  • Sclerotinia sclerotiorum stress
Bra012474
  • F:GTCAACAATCCGCACTACCTACA
  • R:CAACCACGACGGGAAGAAAC
112 81.4 SYBR
ZNF[1] Zinc finger protein
  • Salicylic acid stress
Bra032656
  • F:TTCAGGCGGTTTATGGC
  • R:TCGGGCTTTGCGTAGTT
168 83.4 SYBR
TIP41[1] TIP41-like Protein
  • Salt stress
  • Heavy metal (cr 6+) stress
  • Methyl jasmonate stress
  • Abscisic acid stress
  • Sclerotinia sclerotiorum stress
Bra011516
  • F:TGAAGAGCAGATTGATTTGGCT
  • R:ACACTCCATTGTCAGCCAGTT
101 78.5 SYBR
F-box[1] F-box/kelch-repeat protein
  • Cold stress
  • Salicylic acid stress
Bra006317
  • F:GAGATAAGTCGCTTCCTACCG
  • R:TGTTCCCATTGCCCTGTG
184 81.9 SYBR

Molecular Types

  • mRNA

Evaluation Methods


Contact

  • Name: Zheng Wang
  • Email: xltan@ujs.edu.cn
  • Institution: Institute of life Sciences, Jiangsu University, 301# Xuefu Road, Zhenjiang 212013, People’s Republic of china

Citation Statistics

Cited by 27 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Wang Z, Chen Y, Fang H, et al. Selection of reference genes for quantitative reverse-transcription polymerase chain reaction normalization in Brassica napus under various stress conditions[J]. Molecular genetics and genomics, 2014, 289(5): 1023-1035.

Categories