Difference between revisions of "Brassica oleracea"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
 
==Description==
 
==Description==
 
[[File:REFqPCR2014009-1.jpg|right|227px|]]
 
[[File:REFqPCR2014009-1.jpg|right|227px|]]
* The genus '''''Brassica''''' belongs to the Brassicaceae family. Many Brassica species are important vegetable crops, among which the cole crop, '''''Brassica oleracea'''''. This species has a great diversity of morphotypes (broccoli, cauliflower, collard greens, brussels sprouts) and among them, one of the most important taxonomic variety is viridis (forage kale). '''''B. oleracea''''' is a close relative of the model plant A. thaliana. Both share a common ancestor from which they have diverged 15–20 million years ago. Parts of their corresponding genomes are equivalently organized despite numerous chromosomal rearrangements during respective evolution of the two genera. Brassica oleracea is the most diverse species within the Brassica genus, being important for human nutrition, with multiple cultivars that can be classified by the morphology of their edible structures.  <ref name="ref1"/> <ref name="ref2"/>.
+
* The genus '''''Brassica''''' belongs to the Brassicaceae family. Many Brassica species are important vegetable crops, among which the cole crop, '''''Brassica oleracea'''''. This species has a great diversity of morphotypes (broccoli, cauliflower, collard greens, brussels sprouts) and among them, one of the most important taxonomic variety is viridis (forage kale). Brassica oleracea is the most diverse species within the Brassica genus, being important for human nutrition, with multiple cultivars that can be classified by the morphology of their edible structures.
 +
*'''''B. oleracea''''' is a close relative of the model plant A. thaliana. Both share a common ancestor from which they have diverged 15–20 million years ago. Parts of their corresponding genomes are equivalently organized despite numerous chromosomal rearrangements during respective evolution of the two genera.  <ref name="ref1"/> <ref name="ref2"/>.
  
 
=='''''Abiotic Stresses'''''==
 
=='''''Abiotic Stresses'''''==

Revision as of 06:23, 25 June 2017

Description

REFqPCR2014009-1.jpg
  • The genus Brassica belongs to the Brassicaceae family. Many Brassica species are important vegetable crops, among which the cole crop, Brassica oleracea. This species has a great diversity of morphotypes (broccoli, cauliflower, collard greens, brussels sprouts) and among them, one of the most important taxonomic variety is viridis (forage kale). Brassica oleracea is the most diverse species within the Brassica genus, being important for human nutrition, with multiple cultivars that can be classified by the morphology of their edible structures.
  • B. oleracea is a close relative of the model plant A. thaliana. Both share a common ancestor from which they have diverged 15–20 million years ago. Parts of their corresponding genomes are equivalently organized despite numerous chromosomal rearrangements during respective evolution of the two genera. [1] [2].

Abiotic Stresses

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Ubiq[1] Ubiquitin
  • Universial reference gene
GW695428
  • F:TCCAGGACAAAGAAGGGATTCC
  • R:AGGGCTCTCAAGCTGGGTTCAA
166 60 MESA Blue
Rpl18[1] Ribosomal protein L18
  • Universial reference gene
GW695428
  • F:TCCCTGGCCAAGCTGGTTCG
  • R:CAGGGCCAACTGATCAAATGTGA
201 60 MESA Blue
EF1α[1] Elongation factor 1-alpha
  • Universial reference gene
GW694601
  • F:GGAACTTCCCAGGCAGACTGTGC
  • R:TCAAAACGGGCCGCAGAGAAT
191 60 MESA Blue

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Sylvain Dumez
  • Email: sylvain.dumez@univ-lille2.fr
  • Institution: Laboratoire des Sciences Végétales et Fongiques, Faculté des Sciences Pharmaceutiques et Biologiques, Université Lille Nord de France, EA 4483, Lille 2, B.P. 83, 59006 Lille Cedex, France

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-06-01])


References

  1. 1.0 1.1 1.2 1.3 Brulle F, Bernard F, Vandenbulcke F, Cuny D, Dumez S (2014) Identification of suitable qPCR reference genes in leaves of Brassica oleracea under abiotic stresses. Ecotoxicology 23, 459-471.
  2. Tortosa M, Velasco P, Afonso D, et al. (2017) Characterization of a Spanish Brassica oleracea collection by using molecular and biochemical markers. Scientia Horticulturae 219, 344-350.