Difference between revisions of "Brassica oleracea"

Revision as of 01:34, 29 June 2017

Brassica oleracea belongs to the genus Brassica of Brassicaceae family. It is important vegetable crop which has a great diversity of morphotypes (broccoli, cauliflower, collard greens, brussels sprouts). It is the most diverse species within the Brassica genus, being important for human nutrition, with multiple cultivars that can be classified by the morphology of their edible structures^[1]^[2].
Common Name: Cabbage, Broccoli, Cauliflower, Kale
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
Ubiq^[1]	Ubiquitin	Universial reference gene	GW695428	F:TCCAGGACAAAGAAGGGATTCC R:AGGGCTCTCAAGCTGGGTTCAA	166	60	MESA Blue
Rpl18^[1]	Ribosomal protein L18	Universial reference gene	GW695428	F:TCCCTGGCCAAGCTGGTTCG R:CAGGGCCAACTGATCAAATGTGA	201	60	MESA Blue
EF1α^[1]	Elongation factor 1-alpha	Universial reference gene	GW694601	F:GGAACTTCCCAGGCAGACTGTGC R:TCAAAACGGGCCGCAGAGAAT	191	60	MESA Blue

Name: Sylvain Dumez
Email: sylvain.dumez@univ-lille2.fr
Institution: Laboratoire des Sciences Végétales et Fongiques, Faculté des Sciences Pharmaceutiques et Biologiques, Université Lille Nord de France, EA 4483, Lille 2, B.P. 83, 59006 Lille Cedex, France

Cited by 10 (Based on Google Scholar [2017-06-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Brulle F, Bernard F, Vandenbulcke F, Cuny D, Dumez S (2014) Identification of suitable qPCR reference genes in leaves of Brassica oleracea under abiotic stresses. Ecotoxicology 23, 459-471.
↑ Tortosa M, Velasco P, Afonso D, et al. (2017) Characterization of a Spanish Brassica oleracea collection by using molecular and biochemical markers. Scientia Horticulturae 219, 344-350.

@@ Line 1: / Line 1: @@
 ==Description==
 [[File:Brassica oleracea.png|right|200px|]]
-* The genus '''''Brassica''''' belongs to the Brassicaceae family. Many Brassica species are important vegetable crops, among which the cole crop, '''''Brassica oleracea'''''. This species has a great diversity of morphotypes (broccoli, cauliflower, collard greens, brussels sprouts) and among them, one of the most important taxonomic variety is viridis (forage kale). Brassica oleracea is the most diverse species within the Brassica genus, being important for human nutrition, with multiple cultivars that can be classified by the morphology of their edible structures. <ref name="ref1"/> <ref name="ref2"/>.
+* '''''Brassica oleracea''''' belongs to the genus Brassica of Brassicaceae family. It is important vegetable crop which has a great diversity of morphotypes (broccoli, cauliflower, collard greens, brussels sprouts). It is the most diverse species within the Brassica genus, being important for human nutrition, with multiple cultivars that can be classified by the morphology of their edible structures<ref name="ref1"/><ref name="ref2"/>.
 * <font color=blue>'''Common Name:'''</font> '''Cabbage''', '''Broccoli''', '''Cauliflower''', '''Kale'''
 * [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3712 <font color=blue>'''NCBI Taxonomy'''</font>]