Difference between revisions of "Brassica oleracea"

From ICG
Jump to navigation Jump to search
 
(11 intermediate revisions by 5 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:REFqPCR2014009-1.jpg|right|227px|]]
+
[[File:Brassica oleracea.png|right|200px|]]
* The genus '''''Brassica''''' belongs to the Brassicaceae family. Many Brassica species are important vegetable crops, among which the cole crop, '''''Brassica oleracea'''''. This species has a great diversity of morphotypes (broccoli, cauliflower, collard greens, brussels sprouts) and among them, one of the most important taxonomic variety is viridis (forage kale). Brassica oleracea is the most diverse species within the Brassica genus, being important for human nutrition, with multiple cultivars that can be classified by the morphology of their edible structures. <ref name="ref1"/> <ref name="ref2"/>.
+
* '''''Brassica oleracea''''' belongs to the genus Brassica of Brassicaceae family. It is an important vegetable crop which has a great diversity of morphotypes (broccoli, cauliflower, collard greens, brussels sprouts). It is the most diverse species within the Brassica genus, being important for human nutrition, with multiple cultivars that can be classified by the morphology of their edible structures<ref name="ref1"/><ref name="ref2"/>.
 
* <font color=blue>'''Common Name:'''</font> '''Cabbage''', '''Broccoli''', '''Cauliflower''', '''Kale'''
 
* <font color=blue>'''Common Name:'''</font> '''Cabbage''', '''Broccoli''', '''Cauliflower''', '''Kale'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3712 <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3712 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Abiotic Stresses'''''==
 
=='''''Abiotic Stresses'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 21: Line 21:
 
|align="center"| Ubiquitin
 
|align="center"| Ubiquitin
 
|
 
|
* Universial reference gene
+
* Leaves
 +
* Drought and cold abiotic stresses
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GW695428 '''GW695428''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GW695428 '''GW695428''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 33: Line 34:
 
|align="center"| Ribosomal protein L18
 
|align="center"| Ribosomal protein L18
 
|
 
|
* Universial reference gene
+
* Leaves
 +
* Drought and cold abiotic stresses
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GW695428 '''GW695428''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GW695428 '''GW695428''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 45: Line 47:
 
|align="center"| Elongation factor 1-alpha
 
|align="center"| Elongation factor 1-alpha
 
|
 
|
* Universial reference gene
+
* Leaves
 +
* Drought and cold abiotic stresses
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GW694601 '''GW694601''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GW694601 '''GW694601''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 69: Line 72:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''10''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=11651543811632989386&as_sdt=2005&sciodt=0,5&hl=en '''10'''] (Based on Google Scholar [2017-09-01])
 
 
  
 
=='''References'''==
 
=='''References'''==
Line 81: Line 83:
 
</ref>
 
</ref>
 
</references>
 
</references>
[[Category:Plants]]
+
=='''Categories'''==
[[Category:mRNA]] [[Category:MESA Blue]]
+
[[Category:Plants]][[Category:mRNA]][[Category:MESA Blue]][[Category:EF1α]] [[Category:RPL]] [[Category:Ubiquitin]][[Category:Abiotic Stress]][[Category:geNorm]]
[[Category:EF1α]] [[Category:RPL]] [[Category:Ubiquitin]]
+
[[Category:NormFinder]]
[[Category:Abiotic Stress]]
+
[[Category:BestKeeper]]

Latest revision as of 08:01, 1 September 2017

Description

Brassica oleracea.png
  • Brassica oleracea belongs to the genus Brassica of Brassicaceae family. It is an important vegetable crop which has a great diversity of morphotypes (broccoli, cauliflower, collard greens, brussels sprouts). It is the most diverse species within the Brassica genus, being important for human nutrition, with multiple cultivars that can be classified by the morphology of their edible structures[1][2].
  • Common Name: Cabbage, Broccoli, Cauliflower, Kale
  • NCBI Taxonomy

Abiotic Stresses

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Ubiq[1] Ubiquitin
  • Leaves
  • Drought and cold abiotic stresses
GW695428
  • F:TCCAGGACAAAGAAGGGATTCC
  • R:AGGGCTCTCAAGCTGGGTTCAA
166 60 MESA Blue
Rpl18[1] Ribosomal protein L18
  • Leaves
  • Drought and cold abiotic stresses
GW695428
  • F:TCCCTGGCCAAGCTGGTTCG
  • R:CAGGGCCAACTGATCAAATGTGA
201 60 MESA Blue
EF1α[1] Elongation factor 1-alpha
  • Leaves
  • Drought and cold abiotic stresses
GW694601
  • F:GGAACTTCCCAGGCAGACTGTGC
  • R:TCAAAACGGGCCGCAGAGAAT
191 60 MESA Blue

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Sylvain Dumez
  • Email: sylvain.dumez@univ-lille2.fr
  • Institution: Laboratoire des Sciences Végétales et Fongiques, Faculté des Sciences Pharmaceutiques et Biologiques, Université Lille Nord de France, EA 4483, Lille 2, B.P. 83, 59006 Lille Cedex, France

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Brulle F, Bernard F, Vandenbulcke F, Cuny D, Dumez S (2014) Identification of suitable qPCR reference genes in leaves of Brassica oleracea under abiotic stresses. Ecotoxicology 23, 459-471.
  2. Tortosa M, Velasco P, Afonso D, et al. (2017) Characterization of a Spanish Brassica oleracea collection by using molecular and biochemical markers. Scientia Horticulturae 219, 344-350.

Categories