Difference between revisions of "Brassica oleracea"

From ICG
Jump to navigation Jump to search
Line 21: Line 21:
 
|align="center"| Ubiquitin
 
|align="center"| Ubiquitin
 
|
 
|
* leaves
+
* Leaves
* drought and cold abiotic stresses
+
* Drought and cold abiotic stresses
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GW695428 '''GW695428''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GW695428 '''GW695428''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 34: Line 34:
 
|align="center"| Ribosomal protein L18
 
|align="center"| Ribosomal protein L18
 
|
 
|
* leaves
+
* Leaves
* drought and cold abiotic stresses
+
* Drought and cold abiotic stresses
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GW695428 '''GW695428''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GW695428 '''GW695428''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 47: Line 47:
 
|align="center"| Elongation factor 1-alpha
 
|align="center"| Elongation factor 1-alpha
 
|
 
|
* leaves
+
* Leaves
* drought and cold abiotic stresses
+
* Drought and cold abiotic stresses
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GW694601 '''GW694601''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GW694601 '''GW694601''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|

Revision as of 13:06, 12 August 2017

Description

Brassica oleracea.png
  • Brassica oleracea belongs to the genus Brassica of Brassicaceae family. It is an important vegetable crop which has a great diversity of morphotypes (broccoli, cauliflower, collard greens, brussels sprouts). It is the most diverse species within the Brassica genus, being important for human nutrition, with multiple cultivars that can be classified by the morphology of their edible structures[1][2].
  • Common Name: Cabbage, Broccoli, Cauliflower, Kale
  • NCBI Taxonomy

Abiotic Stresses

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Ubiq[1] Ubiquitin
  • Leaves
  • Drought and cold abiotic stresses
GW695428
  • F:TCCAGGACAAAGAAGGGATTCC
  • R:AGGGCTCTCAAGCTGGGTTCAA
166 60 MESA Blue
Rpl18[1] Ribosomal protein L18
  • Leaves
  • Drought and cold abiotic stresses
GW695428
  • F:TCCCTGGCCAAGCTGGTTCG
  • R:CAGGGCCAACTGATCAAATGTGA
201 60 MESA Blue
EF1α[1] Elongation factor 1-alpha
  • Leaves
  • Drought and cold abiotic stresses
GW694601
  • F:GGAACTTCCCAGGCAGACTGTGC
  • R:TCAAAACGGGCCGCAGAGAAT
191 60 MESA Blue

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Sylvain Dumez
  • Email: sylvain.dumez@univ-lille2.fr
  • Institution: Laboratoire des Sciences Végétales et Fongiques, Faculté des Sciences Pharmaceutiques et Biologiques, Université Lille Nord de France, EA 4483, Lille 2, B.P. 83, 59006 Lille Cedex, France

Citation Statistics

Cited by 10 (Based on Google Scholar [2017-08-10])

References

  1. 1.0 1.1 1.2 1.3 Brulle F, Bernard F, Vandenbulcke F, Cuny D, Dumez S (2014) Identification of suitable qPCR reference genes in leaves of Brassica oleracea under abiotic stresses. Ecotoxicology 23, 459-471.
  2. Tortosa M, Velasco P, Afonso D, et al. (2017) Characterization of a Spanish Brassica oleracea collection by using molecular and biochemical markers. Scientia Horticulturae 219, 344-350.

Categories