Difference between revisions of "Brassica rapa subsp. pekinensis"

From ICG
Jump to navigation Jump to search
(Created page with "=='''Description'''== =='''Different Developmental Stages & Tissues & Treatments'''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |-...")
 
Line 4: Line 4:
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
! Gene symbol  
+
! Gene Symbol  
! Gene name
+
! Gene Name
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
Line 64: Line 64:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
===Moleculer types===
+
===Moleculer Types===
 
* mRNA
 
* mRNA
  
Line 75: Line 75:
 
*'''Email''':  hxl@njau.edu.cn
 
*'''Email''':  hxl@njau.edu.cn
 
*'''Institute''':  State Key Laboratory of Crop Genetics and Germplasm Enhancement; Horticultural College, Nanjing Agricultural University, Nanjing, Jiangsu 210095, China
 
*'''Institute''':  State Key Laboratory of Crop Genetics and Germplasm Enhancement; Horticultural College, Nanjing Agricultural University, Nanjing, Jiangsu 210095, China
 +
===Citation Statistics===
 +
Cited by '''21''' (Based on Google Scholar [2017-06-16])
  
 
==References==
 
==References==

Revision as of 10:12, 16 June 2017

Description

Different Developmental Stages & Tissues & Treatments

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTIN[1] Actin2
  • developmentalstages
AF111812
  • F:GGAGCTGAGAGATTCCGTTG
  • R:GAACCACCACTGAGGACGAT
158 60 SYBR
CyP[1] Cyclophilin
  • developmentalstages
  • different tissues
  • biotic stress treatments
M55018.1
  • F:AGGAGGAGATTTCACCGC
  • R:TCTCTAACGACATCCATCCC
232 58 SYBR
Tub_a[1] tubulin a
  • different tissues
  • biotic stress treatments
AC189186.2
  • F:TTTGGGTTCTCTCTTGCTAG
  • R:CGAGTAGAGAATGAGTTGAG
129 59 SYBR
UBC30[1] ubiquitin-conjugating enzyme 30
  • different tissues
U17250.1
  • F:TGAAAGAGCAGTGGAGCC
  • R:GGTCTGTCTTGTAGGTGTGAGC
122 58 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xi-Lin Hou
  • Email: hxl@njau.edu.cn
  • Institute: State Key Laboratory of Crop Genetics and Germplasm Enhancement; Horticultural College, Nanjing Agricultural University, Nanjing, Jiangsu 210095, China

Citation Statistics

Cited by 21 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 Xiao D, Zhang N W, Zhao J J, et al. Validation of reference genes for real-time quantitative PCR normalisation in non-heading Chinese cabbage[J]. Functional Plant Biology, 2012, 39(4): 342-350.