Brassica rapa subsp. pekinensis

From ICG
Jump to navigation Jump to search

Description

REFqPCRBrassica rapa subsp. pekinensis.jpg
  • Chinese cabbage (Brassica rapa L. ssp. pekinensis) is a subspecies of B. rapa (AA, 2n = 2x = 20) in the Cruciferae family, and is a widely cultivated and economically important vegetable crop in Asia[1].
  • Chinese cabbage is a biennial vegetable crop and is distributed in temperate and subtropical zones, especially in Asia. Thousands of cultivars of Chinese cabbage are available and every year dozens of new cultivars are bred.

Different Developmental Stages & Tissues & Treatments

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTIN[1] Actin2
  • Developmentalstages
AF111812
  • F:GGAGCTGAGAGATTCCGTTG
  • R:GAACCACCACTGAGGACGAT
158 60 SYBR
CyP[1] Cyclophilin
  • Developmentalstages
  • Different tissues
  • Biotic stress treatments
M55018.1
  • F:AGGAGGAGATTTCACCGC
  • R:TCTCTAACGACATCCATCCC
232 58 SYBR
Tub_a[1] tubulin a
  • Different tissues
  • Biotic stress treatments
AC189186.2
  • F:TTTGGGTTCTCTCTTGCTAG
  • R:CGAGTAGAGAATGAGTTGAG
129 59 SYBR
UBC30[1] ubiquitin-conjugating enzyme 30
  • Different tissues
U17250.1
  • F:TGAAAGAGCAGTGGAGCC
  • R:GGTCTGTCTTGTAGGTGTGAGC
122 58 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xi-Lin Hou
  • Email: hxl@njau.edu.cn
  • Institute: State Key Laboratory of Crop Genetics and Germplasm Enhancement; Horticultural College, Nanjing Agricultural University, Nanjing, Jiangsu 210095, China

Citation Statistics

Cited by 21 (Based on Google Scholar [2017-06-16])

Drought Stress & Downy Mildew Infection

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
EF-1-α[2] elongation-factor-1-α
  • Heading leaves;*downy mildew infection leaves of seedlings
GO479260
  • F:ATACCAGGCTTGAGCATACCG
  • R:GCCAAAGAGGCCATCAGACAA
117 55~60 SYBR
GAPDH[2] glyceraldehyde-3-phosphate dehydrogenase
  • Drought stress conditions
AF536826
  • F:CCGCTA ACTGCCTTGCTCCACTT
  • R:GCGGCTCTTCCACCTCTCCAGT
147 55~60 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Fenglan Zhang
  • Email: Fenglan Zhang
  • Institution: Beijing Academy of Agriculture and Forestry Science (BAAFS), Beijing Vegetable Research Center (BVRC), Beijing 100097, China

References

  1. 1.0 1.1 1.2 1.3 1.4 Xiao D, Zhang N W, Zhao J J, et al. Validation of reference genes for real-time quantitative PCR normalisation in non-heading Chinese cabbage[J]. Functional Plant Biology, 2012, 39(4): 342-350.
  2. 2.0 2.1 Qi J, Yu S, Zhang F, et al. Reference gene selection for real-time quantitative polymerase chain reaction of mRNA transcript levels in Chinese cabbage (Brassica rapa L. ssp. pekinensis)[J]. Plant Molecular Biology Reporter, 2010, 28(4): 597-604.