Brassica rapa subsp. pekinensis

From ICG
Jump to navigation Jump to search

Description

Different Developmental Stages & Tissues & Treatments

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
ACTIN[1] Actin2
  • developmentalstages
AF111812
  • F:GGAGCTGAGAGATTCCGTTG
  • R:GAACCACCACTGAGGACGAT
158 60 SYBR
CyP[1] Cyclophilin
  • developmentalstages
  • different tissues
  • biotic stress treatments
M55018.1
  • F:AGGAGGAGATTTCACCGC
  • R:TCTCTAACGACATCCATCCC
232 58 SYBR
Tub_a[1] tubulin a
  • different tissues
  • biotic stress treatments
AC189186.2
  • F:TTTGGGTTCTCTCTTGCTAG
  • R:CGAGTAGAGAATGAGTTGAG
129 59 SYBR
UBC30[1] ubiquitin-conjugating enzyme 30
  • different tissues
U17250.1
  • F:TGAAAGAGCAGTGGAGCC
  • R:GGTCTGTCTTGTAGGTGTGAGC
122 58 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Xi-Lin Hou
  • Email: hxl@njau.edu.cn
  • Institute: State Key Laboratory of Crop Genetics and Germplasm Enhancement; Horticultural College, Nanjing Agricultural University, Nanjing, Jiangsu 210095, China

Citation Statistics

Cited by 21 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 Xiao D, Zhang N W, Zhao J J, et al. Validation of reference genes for real-time quantitative PCR normalisation in non-heading Chinese cabbage[J]. Functional Plant Biology, 2012, 39(4): 342-350.