Difference between revisions of "Bubalus bubalis"
Jump to navigation
Jump to search
ICG Expert4 (talk | contribs) |
|||
Line 25: | Line 25: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:AGCTAAAGGAGTTTCCACCGT | * F:AGCTAAAGGAGTTTCCACCGT | ||
− | * R: | + | * R:GGTGGTAGGTCAATCCGGG |
|align="center"| 207 | |align="center"| 207 | ||
|align="center"| 56~64 | |align="center"| 56~64 | ||
Line 37: | Line 37: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:GTTTGGCTGCACAGTGATGG | * F:GTTTGGCTGCACAGTGATGG | ||
− | * R: | + | * R:TCCCAGATAGGCCTTCCACA |
|align="center"| 143 | |align="center"| 143 | ||
|align="center"| 56~64 | |align="center"| 56~64 |
Revision as of 01:22, 23 June 2017
Contents
Description
- Bubalus bubalis is an important dairy animal in Asian countries, which is a large bovid originating in South Asia, Southeast Asia, and China. Today, it is also found in Europe, Australia, South America and some African countries.It contributes significantly to the agricultural economy and food security of countries on the Indian subcontinent and in Southeast Asia, through milk, meat, hides, and draught power. Buffalo milk is considered to be economical for the production of casein, caseinates, whey protein concentrate, and fat-rich dairy products[1] [2].
- Common Name: Domestic asian water buffalo , Water buffalo
- NCBI Taxonomy
Spermatozoa
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
GLUT5[1] | Solute carrier family 2 (facilitated glucose/fructose transporter), member 5 |
|
NM_001101042.2 |
|
207 | 56~64 | SYBR |
ATP2B4[1] | ATPase, Ca2+ transporting,plasma membrane 4 |
|
NM_001172594 |
|
143 | 56~64 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
- Ref-Finder method && Related Reference
- ΔCt approach method && Related Reference
Contact
- Name: S.K. Bhure
- Email: sdbhure@rediffmail.com
- Institution: Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, 243122, Bareilly, U.P., India
Citation Statistics
Cited by 0 (Based on Google Scholar [2017-06-01])
References
- ↑ 1.0 1.1 1.2 Ashish S, Bhure SK, Harikrishna P, Ramteke SS, Muhammed Kutty VH, Shruthi N, Ravi Kumar GV, Manish M, Ghosh SK, Mihir S. Identification and evaluation of reference genes for accurate gene expression normalization of fresh and frozen-thawed spermatozoa of water buffalo (Bubalus bubalis). Theriogenology. 2017 Apr 1;92:6-13. doi: 10.1016/j.theriogenology.2017.01.006. Epub 2017 Jan 8. PubMed PMID: 28237344.
- ↑ Vijh RK, Tantia MS, Mishra B, Bharani Kumar ST. Genetic relationship and diversity analysis of Indian water buffalo (Bubalus bubalis). J Anim Sci. 2008 Jul;86(7):1495-502. doi: 10.2527/jas.2007-0321. Epub 2008 Mar 14. PubMed PMID: 18344309.