Difference between revisions of "Bubalus bubalis"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
[[File:REFqPCR2017001-1.jpg|right|200px|]]
+
[[File:Bubalus bubalis.png|right|200px|]]
 
* '''''Bubalus bubalis''''' is an important dairy animal in  Asian  countries, which is a large bovid originating in South Asia, Southeast Asia, and China. Today, it is also found in Europe, Australia, South America and some African countries.It contributes significantly to the agricultural economy and food security of countries on the Indian subcontinent and in Southeast Asia, through  milk,  meat,  hides,  and draught power. Buffalo milk is considered to be economical for the production of casein, caseinates, whey protein concentrate, and fat-rich dairy products<ref name="ref1"/> <ref name="ref2"/>.
 
* '''''Bubalus bubalis''''' is an important dairy animal in  Asian  countries, which is a large bovid originating in South Asia, Southeast Asia, and China. Today, it is also found in Europe, Australia, South America and some African countries.It contributes significantly to the agricultural economy and food security of countries on the Indian subcontinent and in Southeast Asia, through  milk,  meat,  hides,  and draught power. Buffalo milk is considered to be economical for the production of casein, caseinates, whey protein concentrate, and fat-rich dairy products<ref name="ref1"/> <ref name="ref2"/>.
 
* <font color=blue>'''Common Name:'''</font> '''Domestic asian water buffalo ''',''' Water buffalo'''
 
* <font color=blue>'''Common Name:'''</font> '''Domestic asian water buffalo ''',''' Water buffalo'''

Revision as of 14:26, 26 June 2017

Description

Bubalus bubalis.png
  • Bubalus bubalis is an important dairy animal in Asian countries, which is a large bovid originating in South Asia, Southeast Asia, and China. Today, it is also found in Europe, Australia, South America and some African countries.It contributes significantly to the agricultural economy and food security of countries on the Indian subcontinent and in Southeast Asia, through milk, meat, hides, and draught power. Buffalo milk is considered to be economical for the production of casein, caseinates, whey protein concentrate, and fat-rich dairy products[1] [2].
  • Common Name: Domestic asian water buffalo , Water buffalo
  • NCBI Taxonomy

Spermatozoa

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GLUT5[1] Solute carrier family 2 (facilitated glucose/fructose transporter), member 5
  • Fresh and frozen-thawed spermatozoa
NM_001101042.2
  • F:AGCTAAAGGAGTTTCCACCGT
  • R:GGTGGTAGGTCAATCCGGG
207 56~64 SYBR
ATP2B4[1] ATPase, Ca2+ transporting,plasma membrane 4
  • Fresh and frozen-thawed spermatozoa
NM_001172594
  • F:GTTTGGCTGCACAGTGATGG
  • R:TCCCAGATAGGCCTTCCACA
143 56~64 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: S.K. Bhure
  • Email: sdbhure@rediffmail.com
  • Institution: Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, 243122, Bareilly, U.P., India

Citation Statistics

Cited by 0 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 Ashish S, Bhure SK, Harikrishna P, Ramteke SS, Muhammed Kutty VH, Shruthi N, Ravi Kumar GV, Manish M, Ghosh SK, Mihir S. Identification and evaluation of reference genes for accurate gene expression normalization of fresh and frozen-thawed spermatozoa of water buffalo (Bubalus bubalis). Theriogenology. 2017 Apr 1;92:6-13. doi: 10.1016/j.theriogenology.2017.01.006. Epub 2017 Jan 8. PubMed PMID: 28237344.
  2. Vijh RK, Tantia MS, Mishra B, Bharani Kumar ST. Genetic relationship and diversity analysis of Indian water buffalo (Bubalus bubalis). J Anim Sci. 2008 Jul;86(7):1495-502. doi: 10.2527/jas.2007-0321. Epub 2008 Mar 14. PubMed PMID: 18344309.