Difference between revisions of "Bubalus bubalis"
Jump to navigation
Jump to search
Niu Guangyi (talk | contribs) |
|||
(24 intermediate revisions by 6 users not shown) | |||
Line 1: | Line 1: | ||
=='''Description'''== | =='''Description'''== | ||
− | [[File: | + | [[File:Bubalus bubalis.png|right|200px|link=Bubalus bubalis]] |
− | * '''Bubalus bubalis''' is an important dairy animal in Asian countries, which is a large bovid originating in South Asia, Southeast Asia, and China. Today, it is also found in Europe, Australia, South America and some African countries.It contributes significantly to the agricultural economy and food security of countries on the Indian subcontinent and in Southeast Asia, through milk, meat, hides, and draught power. Buffalo milk is considered to be economical for the production of casein, caseinates, whey protein concentrate, and fat-rich dairy products<ref name="ref1"/> <ref name="ref2"/>. | + | * '''''Bubalus bubalis''''' is an important dairy animal in Asian countries, which is a large bovid originating in South Asia, Southeast Asia, and China. Today, it is also found in Europe, Australia, South America and some African countries.It contributes significantly to the agricultural economy and food security of countries on the Indian subcontinent and in Southeast Asia, through milk, meat, hides, and draught power. Buffalo milk is considered to be economical for the production of casein, caseinates, whey protein concentrate, and fat-rich dairy products<ref name="ref1"/> <ref name="ref2"/>. |
* <font color=blue>'''Common Name:'''</font> '''Domestic asian water buffalo ''',''' Water buffalo''' | * <font color=blue>'''Common Name:'''</font> '''Domestic asian water buffalo ''',''' Water buffalo''' | ||
− | * [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=89462 <font color=blue>'''NCBI Taxonomy | + | * [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=89462 <font color=blue>'''NCBI Taxonomy'''</font>] |
=='''''Spermatozoa'''''== | =='''''Spermatozoa'''''== | ||
− | === | + | ===Internal Control Genes=== |
+ | |||
{|class="wikitable sortable" style="font-size:10pt; width:100%" | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
|- | |- | ||
Line 25: | Line 26: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:AGCTAAAGGAGTTTCCACCGT | * F:AGCTAAAGGAGTTTCCACCGT | ||
− | * R: | + | * R:GGTGGTAGGTCAATCCGGG |
|align="center"| 207 | |align="center"| 207 | ||
|align="center"| 56~64 | |align="center"| 56~64 | ||
Line 37: | Line 38: | ||
|nowrap style="font-size:9pt"| | |nowrap style="font-size:9pt"| | ||
* F:GTTTGGCTGCACAGTGATGG | * F:GTTTGGCTGCACAGTGATGG | ||
− | * R: | + | * R:TCCCAGATAGGCCTTCCACA |
|align="center"| 143 | |align="center"| 143 | ||
|align="center"| 56~64 | |align="center"| 56~64 | ||
Line 43: | Line 44: | ||
|} | |} | ||
− | === | + | ===Molecular Types=== |
*mRNA | *mRNA | ||
===Evaluation Methods=== | ===Evaluation Methods=== | ||
Line 58: | Line 59: | ||
===Citation Statistics=== | ===Citation Statistics=== | ||
− | Cited by '''0''' (Based on Google Scholar [2017- | + | Cited by [https://scholar.google.com/scholar?q=related:I2I3Nvx7qnIJ:scholar.google.com/&hl=en&as_sdt=0,5 '''0'''] (Based on Google Scholar [2017-09-01]) |
+ | |||
+ | =='''''Mammary Epithelial Cells'''''== | ||
+ | ===Reference Genes=== | ||
+ | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
+ | |- | ||
+ | ! Gene Symbol | ||
+ | ! Gene Name | ||
+ | ! style="width=25% font-size:9pt "|Application Scope | ||
+ | ! Accession Number | ||
+ | ! Primers (5'-3')<br>[Forward/Reverse] | ||
+ | ! Size [bp] | ||
+ | ! Tm [℃] | ||
+ | ! Detection | ||
+ | |- | ||
+ | |align="center"| RPS9<ref name="ref3"/> | ||
+ | |align="center"| ribosomal protein S9 | ||
+ | | | ||
+ | *Mammary epithelial cells during different phases of lactation | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/NM_001101152 '''NM_001101152 '''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CCTCGACCAAGAGCTGAAG | ||
+ | * R:CCTCCAGACCTCACGTTTGTTC | ||
+ | |align="center"| NA | ||
+ | |align="center"| NA | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| RPS23<ref name="ref3"/> | ||
+ | |align="center"| ribosomal protein S23 | ||
+ | | | ||
+ | *Mammary epithelial cells during different phases of lactation | ||
+ | |align="center"| [https://www.ncbi.nlm.nih.gov/gene/?term=NP_001029862.1 '''NP_001029862.1'''] | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CCCAATGATGGTTGCTTGAA | ||
+ | * R:CGGACTCCAGGAATGTCACC | ||
+ | |align="center"| NA | ||
+ | |align="center"| NA | ||
+ | |align="center"| SYBR | ||
+ | |} | ||
+ | ===Molecular Types=== | ||
+ | * mRNA | ||
+ | |||
+ | ===Evaluation Methods=== | ||
+ | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
+ | * [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference'''] | ||
+ | ===Contact=== | ||
+ | *'''Name''': B.P. Mishra | ||
+ | *'''Email''': bpmishra_1@hotmail.com | ||
+ | *'''Institution''': National Bureau of Animal Genetic Resources, Karnal 132001, Haryana, India | ||
+ | ===Citation Statistics=== | ||
+ | Cited by [https://scholar.google.com/scholar?cites=16520028400192373503&as_sdt=2005&sciodt=0,5&hl=en '''18'''] (Based on Google Scholar [2017-09-01]) | ||
=='''References'''== | =='''References'''== | ||
Line 75: | Line 126: | ||
Jul;86(7):1495-502. doi: 10.2527/jas.2007-0321. Epub 2008 Mar 14. PubMed PMID: | Jul;86(7):1495-502. doi: 10.2527/jas.2007-0321. Epub 2008 Mar 14. PubMed PMID: | ||
18344309. | 18344309. | ||
+ | </ref> | ||
+ | <ref name="ref3"> | ||
+ | Yadav, Poonam, et al. Identification of suitable housekeeping genes for expression analysis in mammary epithelial cells of buffalo (Bubalus bubalis) during lactation cycle. Livestock Science 147.1 (2012): 72-76. | ||
</ref> | </ref> | ||
</references> | </references> | ||
− | + | =='''Categories'''== | |
[[Category:Animals]] | [[Category:Animals]] | ||
− | [[Category:mRNA]] | + | [[Category:mRNA]] |
[[Category:SYBR]] | [[Category:SYBR]] | ||
[[Category:ATP2B4]] [[Category:GLUT5]] | [[Category:ATP2B4]] [[Category:GLUT5]] | ||
[[Category:Specific Tissue]] | [[Category:Specific Tissue]] | ||
+ | [[Category:Different Developmental Stages]] | ||
+ | [[Category:RPS]] | ||
+ | [[Category:Multiple Projects]] | ||
+ | [[Category:geNorm]] | ||
+ | [[Category:NormFinder]] | ||
+ | [[Category:BestKeeper]] | ||
+ | [[Category:Delta Ct]] | ||
+ | [[Category:RefFinder]] |
Latest revision as of 06:44, 1 September 2017
Contents
Description
- Bubalus bubalis is an important dairy animal in Asian countries, which is a large bovid originating in South Asia, Southeast Asia, and China. Today, it is also found in Europe, Australia, South America and some African countries.It contributes significantly to the agricultural economy and food security of countries on the Indian subcontinent and in Southeast Asia, through milk, meat, hides, and draught power. Buffalo milk is considered to be economical for the production of casein, caseinates, whey protein concentrate, and fat-rich dairy products[1] [2].
- Common Name: Domestic asian water buffalo , Water buffalo
- NCBI Taxonomy
Spermatozoa
Internal Control Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
GLUT5[1] | Solute carrier family 2 (facilitated glucose/fructose transporter), member 5 |
|
NM_001101042.2 |
|
207 | 56~64 | SYBR |
ATP2B4[1] | ATPase, Ca2+ transporting,plasma membrane 4 |
|
NM_001172594 |
|
143 | 56~64 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
- Ref-Finder method && Related Reference
- ΔCt approach method && Related Reference
Contact
- Name: S.K. Bhure
- Email: sdbhure@rediffmail.com
- Institution: Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, 243122, Bareilly, U.P., India
Citation Statistics
Cited by 0 (Based on Google Scholar [2017-09-01])
Mammary Epithelial Cells
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
RPS9[3] | ribosomal protein S9 |
|
NM_001101152 |
|
NA | NA | SYBR |
RPS23[3] | ribosomal protein S23 |
|
NP_001029862.1 |
|
NA | NA | SYBR |
Molecular Types
- mRNA
Evaluation Methods
Contact
- Name: B.P. Mishra
- Email: bpmishra_1@hotmail.com
- Institution: National Bureau of Animal Genetic Resources, Karnal 132001, Haryana, India
Citation Statistics
Cited by 18 (Based on Google Scholar [2017-09-01])
References
- ↑ 1.0 1.1 1.2 Ashish S, Bhure SK, Harikrishna P, Ramteke SS, Muhammed Kutty VH, Shruthi N, Ravi Kumar GV, Manish M, Ghosh SK, Mihir S. Identification and evaluation of reference genes for accurate gene expression normalization of fresh and frozen-thawed spermatozoa of water buffalo (Bubalus bubalis). Theriogenology. 2017 Apr 1;92:6-13. doi: 10.1016/j.theriogenology.2017.01.006. Epub 2017 Jan 8. PubMed PMID: 28237344.
- ↑ Vijh RK, Tantia MS, Mishra B, Bharani Kumar ST. Genetic relationship and diversity analysis of Indian water buffalo (Bubalus bubalis). J Anim Sci. 2008 Jul;86(7):1495-502. doi: 10.2527/jas.2007-0321. Epub 2008 Mar 14. PubMed PMID: 18344309.
- ↑ 3.0 3.1 Yadav, Poonam, et al. Identification of suitable housekeeping genes for expression analysis in mammary epithelial cells of buffalo (Bubalus bubalis) during lactation cycle. Livestock Science 147.1 (2012): 72-76.