Difference between revisions of "Bubalus bubalis"

From ICG
Jump to navigation Jump to search
 
(3 intermediate revisions by 3 users not shown)
Line 59: Line 59:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''0''' (Based on Google Scholar [2017-08-10])
+
Cited by [https://scholar.google.com/scholar?q=related:I2I3Nvx7qnIJ:scholar.google.com/&hl=en&as_sdt=0,5 '''0'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Mammary Epithelial Cells'''''==
 
=='''''Mammary Epithelial Cells'''''==
Line 98: Line 98:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
===Moleculer Type===
+
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 108: Line 109:
 
*'''Institution''': National Bureau of Animal Genetic Resources, Karnal 132001, Haryana, India
 
*'''Institution''': National Bureau of Animal Genetic Resources, Karnal 132001, Haryana, India
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''18''' (Based on Google Scholar [2017-08-10])
+
Cited by [https://scholar.google.com/scholar?cites=16520028400192373503&as_sdt=2005&sciodt=0,5&hl=en '''18'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 127: Line 128:
 
</ref>
 
</ref>
 
<ref name="ref3">
 
<ref name="ref3">
Yadav, Poonam, et al. "Identification of suitable housekeeping genes for expression analysis in mammary epithelial cells of buffalo (Bubalus bubalis) during lactation cycle." Livestock Science 147.1 (2012): 72-76.
+
Yadav, Poonam, et al. Identification of suitable housekeeping genes for expression analysis in mammary epithelial cells of buffalo (Bubalus bubalis) during lactation cycle. Livestock Science 147.1 (2012): 72-76.
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 
=='''Categories'''==
 
=='''Categories'''==
 
[[Category:Animals]]
 
[[Category:Animals]]

Latest revision as of 06:44, 1 September 2017

Description

Bubalus bubalis.png
  • Bubalus bubalis is an important dairy animal in Asian countries, which is a large bovid originating in South Asia, Southeast Asia, and China. Today, it is also found in Europe, Australia, South America and some African countries.It contributes significantly to the agricultural economy and food security of countries on the Indian subcontinent and in Southeast Asia, through milk, meat, hides, and draught power. Buffalo milk is considered to be economical for the production of casein, caseinates, whey protein concentrate, and fat-rich dairy products[1] [2].
  • Common Name: Domestic asian water buffalo , Water buffalo
  • NCBI Taxonomy

Spermatozoa

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GLUT5[1] Solute carrier family 2 (facilitated glucose/fructose transporter), member 5
  • Fresh and frozen-thawed spermatozoa
NM_001101042.2
  • F:AGCTAAAGGAGTTTCCACCGT
  • R:GGTGGTAGGTCAATCCGGG
207 56~64 SYBR
ATP2B4[1] ATPase, Ca2+ transporting,plasma membrane 4
  • Fresh and frozen-thawed spermatozoa
NM_001172594
  • F:GTTTGGCTGCACAGTGATGG
  • R:TCCCAGATAGGCCTTCCACA
143 56~64 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: S.K. Bhure
  • Email: sdbhure@rediffmail.com
  • Institution: Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, 243122, Bareilly, U.P., India

Citation Statistics

Cited by 0 (Based on Google Scholar [2017-09-01])

Mammary Epithelial Cells

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPS9[3] ribosomal protein S9
  • Mammary epithelial cells during different phases of lactation
NM_001101152
  • F:CCTCGACCAAGAGCTGAAG
  • R:CCTCCAGACCTCACGTTTGTTC
NA NA SYBR
RPS23[3] ribosomal protein S23
  • Mammary epithelial cells during different phases of lactation
NP_001029862.1
  • F:CCCAATGATGGTTGCTTGAA
  • R:CGGACTCCAGGAATGTCACC
NA NA SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: B.P. Mishra
  • Email: bpmishra_1@hotmail.com
  • Institution: National Bureau of Animal Genetic Resources, Karnal 132001, Haryana, India

Citation Statistics

Cited by 18 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Ashish S, Bhure SK, Harikrishna P, Ramteke SS, Muhammed Kutty VH, Shruthi N, Ravi Kumar GV, Manish M, Ghosh SK, Mihir S. Identification and evaluation of reference genes for accurate gene expression normalization of fresh and frozen-thawed spermatozoa of water buffalo (Bubalus bubalis). Theriogenology. 2017 Apr 1;92:6-13. doi: 10.1016/j.theriogenology.2017.01.006. Epub 2017 Jan 8. PubMed PMID: 28237344.
  2. Vijh RK, Tantia MS, Mishra B, Bharani Kumar ST. Genetic relationship and diversity analysis of Indian water buffalo (Bubalus bubalis). J Anim Sci. 2008 Jul;86(7):1495-502. doi: 10.2527/jas.2007-0321. Epub 2008 Mar 14. PubMed PMID: 18344309.
  3. 3.0 3.1 Yadav, Poonam, et al. Identification of suitable housekeeping genes for expression analysis in mammary epithelial cells of buffalo (Bubalus bubalis) during lactation cycle. Livestock Science 147.1 (2012): 72-76.

Categories