Difference between revisions of "Buglossoides arvensis"

From ICG
Jump to navigation Jump to search
Line 68: Line 68:
  
 
[[Category:Plants]]
 
[[Category:Plants]]
 +
[[Category:mRNA]] 
 +
[[Category:SYBR]]

Revision as of 07:43, 19 June 2017

Description

REFqPCR2015009-1.JPG
  • In many model organisms like Arabidopsis thaliana, Medicago truncatula, rice (Oryza sativa), soybean (Glycine max) or maize (Zea mays), exhaustive gene expression maps have been developed, which are publicly accessible. One example of such a non-model system is Buglossoides arvensis (L.) I. M. Johnston, a member of the plant family Boraginaceae. Commonly referred to as corn grom-well, or more recently as Ahiflower™ (http://www.ahiflower.com), this weed plant has evoked high interest amongst researchers for its nutraceutical value, more specifically for its propensity to naturally accumulate in its seeds a non-traditional plant lipid, stearidonic acid (SDA, C18:4n-3).
  • Buglossoides arvensis (Ahiflower) oil is a dietary oil rich in stearidonic acid (20% SDA; 18:4 n-3). The present randomized, double blind, placebo-controlled clinical trial investigated the effects of three Ahiflower oil dosages on omega-3 polyunsaturated fatty acid (PUFA) content of plasma and mononuclear cells (MCs) and of the highest Ahiflower dosage on stimulated cytokine production in blood.
  • The SDA-rich Ahiflower oil (45% ALA, 20% SDA) extracted from the seed of Buglossoides arvensis, was recently shown in a randomized comparator-controlled trial to be more efficient than ALA-rich flaxseed oil (60% ALA) at increasing serum, erythrocyte, mononuclear cell and neutrophil EPA and docosapentaenoic acid (DPA, 22:5 n-3) contents, consistent with the poor conversion of ALA to SDA owing to a rate-limiting Δ6-desaturase, as shown by stable isotope tracer studies. [1] [2].

Different Tissues & Growth Regimes

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
CAC[1] Clathrin adaptor complexes
  • Universal reference gene
KJ883539
  • F:TTGACTGTTTGGTTTGGAAGATAAGA
  • R:TTGACTGTTTGGTTTGGAAGATAAGA
NA 60 SYBR
α-tub[1] Alpha tubulin
  • Universal reference gene
KJ920355
  • F:CCTGAGAAACAAGCCTGTTGAGA
  • R:CCTGAGAAACAAGCCTGTTGAGA
NA 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Martin Filion
  • Email: martin.filion@umoncton.ca
  • Institution: Department of Biology, Université de Moncton, 18 Antonine-Maillet Ave, Moncton, NB E1A 3E9, Canada

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 Gadkar VJ, Filion M (2015) Validation of endogenous reference genes in Buglossoides arvensis for normalizing RT-qPCR-based gene expression data. Springerplus 4, 178.
  2. Lefort N, Le Blanc R, Surette ME (2017) Dietary Buglossoides Arvensis Oil Increases Circulating n-3 Polyunsaturated Fatty Acids in a Dose-Dependent Manner and Enhances Lipopolysaccharide-Stimulated Whole Blood Interleukin-10-A Randomized Placebo-Controlled Trial. Nutrients 9.