Difference between revisions of "Burkholderia pyrrocinia"

From ICG
Jump to navigation Jump to search
 
(One intermediate revision by one other user not shown)
Line 42: Line 42:
 
*'''Name''': Jian-Ren Ye
 
*'''Name''': Jian-Ren Ye
 
*'''Email''': jrye@njfu.edu.cn
 
*'''Email''': jrye@njfu.edu.cn
*'''Institute''': College of Forestry and Co-Innovation Center for Sustainable Forestry in Southern China, Jiangsu Key Laboratory for Prevention and Management of Invasive Species, Nanjing Forestry University, Nanjing, Jiangsu, China
+
*'''Institution''': College of Forestry and Co-Innovation Center for Sustainable Forestry in Southern China, Jiangsu Key Laboratory for Prevention and Management of Invasive Species, Nanjing Forestry University, Nanjing, Jiangsu, China
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''1''' (Based on Google Scholar [2017-08-10])
+
Cited by [https://scholar.google.com/scholar?cites=4799737750387500752&as_sdt=2005&sciodt=0,5&hl=en '''1'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==

Latest revision as of 05:08, 1 September 2017

Description

Burkholderia pyrrocinia-1.jpg
  • Burkholderia pyrrocinia is the Burkholderia cepacia complex (Bcc) species most frequently associated with roots of crop plants. The endophytic bacterium Burkholderia pyrrocinia strain JK-SH007 isolated from poplar stems plays a highly significant role in the growth promotion and the biocontrol of poplar canker during colonization in poplar[1][2].
  • Common Name: Unknown
  • NCBI Taxonomy

Different Growth Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
pyrG[1] CTP synthetase
  • Poplar stem
  • Time, pH, temperature
  • Different concentrations of saline
NA
  • F:AGTCACCCTCCTCAAACTCG
  • R:TCGTGAAGTTGTTGGCCTTG
1170 52 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jian-Ren Ye
  • Email: jrye@njfu.edu.cn
  • Institution: College of Forestry and Co-Innovation Center for Sustainable Forestry in Southern China, Jiangsu Key Laboratory for Prevention and Management of Invasive Species, Nanjing Forestry University, Nanjing, Jiangsu, China

Citation Statistics

Cited by 1 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 Wu BY, Ye JR, Huang L, He LM, Li DW. Validation of reference genes for RT-qPCR analysis in Burkholderia pyrrocinia JK-SH007. J Microbiol Methods. 2017 Jan;132:95-98. doi: 10.1016/j.mimet.2016.10.004. Epub 2016 Oct 8. PubMed PMID: 27725176.
  2. Alisi C, Lasinio G J, Dalmastri C, et al. Metabolic profiling of Burkholderia cenocepacia, Burkholderia ambifaria, and Burkholderia pyrrocinia isolates from maize rhizosphere[J]. Microbial ecology, 2005, 50(3): 385-395.

Categories