Difference between revisions of "Burkholderia pyrrocinia"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
 
[[File:Burkholderia pyrrocinia-1.jpg|right|200px|link=Burkholderia pyrrocinia]]
 
[[File:Burkholderia pyrrocinia-1.jpg|right|200px|link=Burkholderia pyrrocinia]]
*  '''''Burkholderia pyrrocinia''''' is  the Burkholderia cepacia complex (Bcc) species most frequently associated with roots of crop plants. The endophytic bacterium Burkholderia pyrrocinia JK-SH007 was isolated from a poplar stem, and it showed strong growth-promoting and antifungal activities<ref name="ref1"/><ref name="ref2"/>.
+
*  '''''Burkholderia pyrrocinia''''' is  the Burkholderia cepacia complex (Bcc) species most frequently associated with roots of crop plants. The endophytic bacterium Burkholderia pyrrocinia strain JK-SH007 isolated from poplar stems plays a highly significant role in the growth promotion and the biocontrol of poplar canker during colonization in poplar<ref name="ref1"/><ref name="ref2"/>.
 
* <font color=blue>'''Common Name:'''</font> '''Unknown'''
 
* <font color=blue>'''Common Name:'''</font> '''Unknown'''
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=60550&lvl=3&lin=f&keep=1&srchmode=1&unlock <font color=blue>'''NCBI Taxonomy'''</font>]
 
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=60550&lvl=3&lin=f&keep=1&srchmode=1&unlock <font color=blue>'''NCBI Taxonomy'''</font>]

Revision as of 02:11, 10 August 2017

Description

Burkholderia pyrrocinia-1.jpg
  • Burkholderia pyrrocinia is the Burkholderia cepacia complex (Bcc) species most frequently associated with roots of crop plants. The endophytic bacterium Burkholderia pyrrocinia strain JK-SH007 isolated from poplar stems plays a highly significant role in the growth promotion and the biocontrol of poplar canker during colonization in poplar[1][2].
  • Common Name: Unknown
  • NCBI Taxonomy

Different Growth Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
pyrG[1] CTP synthetase
  • Poplar stem
  • Time,pH, temperature
  • Different concentrations of saline
NA
  • F:AGTCACCCTCCTCAAACTCG
  • R:TCGTGAAGTTGTTGGCCTTG
1170 52 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Jian-Ren Ye
  • Email: jrye@njfu.edu.cn
  • Institute: College of Forestry and Co-Innovation Center for Sustainable Forestry in Southern China, Jiangsu Key Laboratory for Prevention and Management of Invasive Species, Nanjing Forestry University, Nanjing, Jiangsu, China

Citation Statistics

Cited by ?? (Based on Google Scholar [2017-08-01])

References

  1. 1.0 1.1 Wu BY, Ye JR, Huang L, He LM, Li DW. Validation of reference genes for RT-qPCR analysis in Burkholderia pyrrocinia JK-SH007. J Microbiol Methods. 2017 Jan;132:95-98. doi: 10.1016/j.mimet.2016.10.004. Epub 2016 Oct 8. PubMed PMID: 27725176.
  2. Alisi C, Lasinio G J, Dalmastri C, et al. Metabolic profiling of Burkholderia cenocepacia, Burkholderia ambifaria, and Burkholderia pyrrocinia isolates from maize rhizosphere[J]. Microbial ecology, 2005, 50(3): 385-395.

Categories