Burkholderia pyrrocinia

From ICG
Jump to navigation Jump to search

Description

Burkholderia pyrrocinia-1.jpg
  • Burkholderia pyrrocinia is the Burkholderia cepacia complex (Bcc) species most frequently associated with roots of crop plants. The endophytic bacterium Burkholderia pyrrocinia strain JK-SH007 isolated from poplar stems plays a highly significant role in the growth promotion and the biocontrol of poplar canker during colonization in poplar[1][2].
  • Common Name: Unknown
  • NCBI Taxonomy

Different Growth Conditions

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
pyrG[1] CTP synthetase
  • Poplar stem
  • Time, pH, temperature
  • Different concentrations of saline
NA
  • F:AGTCACCCTCCTCAAACTCG
  • R:TCGTGAAGTTGTTGGCCTTG
1170 52 SYBR

Moleculer types

  • mRNA

Evaluation Methods

Contact

  • Name: Jian-Ren Ye
  • Email: jrye@njfu.edu.cn
  • Institute: College of Forestry and Co-Innovation Center for Sustainable Forestry in Southern China, Jiangsu Key Laboratory for Prevention and Management of Invasive Species, Nanjing Forestry University, Nanjing, Jiangsu, China

Citation Statistics

Cited by ?? (Based on Google Scholar [2017-08-01])

References

  1. 1.0 1.1 Wu BY, Ye JR, Huang L, He LM, Li DW. Validation of reference genes for RT-qPCR analysis in Burkholderia pyrrocinia JK-SH007. J Microbiol Methods. 2017 Jan;132:95-98. doi: 10.1016/j.mimet.2016.10.004. Epub 2016 Oct 8. PubMed PMID: 27725176.
  2. Alisi C, Lasinio G J, Dalmastri C, et al. Metabolic profiling of Burkholderia cenocepacia, Burkholderia ambifaria, and Burkholderia pyrrocinia isolates from maize rhizosphere[J]. Microbial ecology, 2005, 50(3): 385-395.

Categories