Difference between revisions of "Caenorhabditis elegans"

From ICG
Jump to navigation Jump to search
Line 3: Line 3:
 
[[File:Caenorhabditis elegans-1.jpg|right|327px|]]
 
[[File:Caenorhabditis elegans-1.jpg|right|327px|]]
 
* The nematode Caenorhabditis elegans (C. elegans), a simple and welldefined genetic model, has gained increasing popularity among scientists to study the molecular mechanism of emerging materials.Nematodes are the most abundant soil-dwelling invertebrates that occupied a key position in terrestrial ecosystem by influencing energy transfer and nutrient cycling. C. elegans, a free-living nematode that feeds on soil microorganisms, is a simple multicellular eukaryote with its genome first completely sequenced and its cell lineage well described. C. elegans has a short life span, is easy to culture in the laboratory, either in aqueous or in soil matrices. Furthermore, the genome of C. elegans showed a high level of conservation with human’s genome<ref name="ref1"/> <ref name="ref2"/>.
 
* The nematode Caenorhabditis elegans (C. elegans), a simple and welldefined genetic model, has gained increasing popularity among scientists to study the molecular mechanism of emerging materials.Nematodes are the most abundant soil-dwelling invertebrates that occupied a key position in terrestrial ecosystem by influencing energy transfer and nutrient cycling. C. elegans, a free-living nematode that feeds on soil microorganisms, is a simple multicellular eukaryote with its genome first completely sequenced and its cell lineage well described. C. elegans has a short life span, is easy to culture in the laboratory, either in aqueous or in soil matrices. Furthermore, the genome of C. elegans showed a high level of conservation with human’s genome<ref name="ref1"/> <ref name="ref2"/>.
 +
* <font color=blue>'''Common Name:'''</font> '''Worm'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=6239 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Nanotoxicity'''''==
 
=='''''Nanotoxicity'''''==

Revision as of 01:32, 25 June 2017

Description

Caenorhabditis elegans-1.jpg
  • The nematode Caenorhabditis elegans (C. elegans), a simple and welldefined genetic model, has gained increasing popularity among scientists to study the molecular mechanism of emerging materials.Nematodes are the most abundant soil-dwelling invertebrates that occupied a key position in terrestrial ecosystem by influencing energy transfer and nutrient cycling. C. elegans, a free-living nematode that feeds on soil microorganisms, is a simple multicellular eukaryote with its genome first completely sequenced and its cell lineage well described. C. elegans has a short life span, is easy to culture in the laboratory, either in aqueous or in soil matrices. Furthermore, the genome of C. elegans showed a high level of conservation with human’s genome[1] [2].
  • Common Name: Worm
  • NCBI Taxonomy

Nanotoxicity

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
tba-1[1] Tubulin, alpha family member
  • Nanoparticle-induced genetic response
NA
  • F:TCAACACTGCCATCGCCGCC
  • R:TCCAAGCGAGACCAGGCTTCAG
NA 60 SYBR
Y45F10D.4[1] Putative iron-sulfur cluster assembly enzyme
  • Nanoparticle-induced genetic response
NA
  • F:ATCAGATACCGTCGTAGTTC
  • R:TTCCGTCAATTCCTTTAAG
NA 60 SYBR
pmp-3[1] Peroxisomal membrane protein related
  • Nanoparticle-induced genetic response
NA
  • F:TGGCCGGATGATGGTGTCGC
  • R:ACGAACAATGCCAAAGGCCAGC
NA 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Yanqiong Zhang
  • Email: Panx@ecu.edu
  • Institution: Department of Biology, East Carolina University, Greenville, North Carolina, United States of America

Citation Statistics

Cited by 65 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 Zhang Y, Chen D, Smith M A, et al. Selection of reliable reference genes in Caenorhabditis elegans for analysis of nanotoxicity[J]. PloS one, 2012, 7(3): e31849.
  2. Murray AR, Kisin E, Leonard SS, Young SH, Kommineni C, et al. Oxidative stress and inflammatory response in dermal toxicity of single-walled carbon nanotubes. Toxicology 257: 161–171.