Difference between revisions of "Callithrix jacchus"

Revision as of 08:45, 17 August 2017

Callithrix jacchus is a small New World primate that is native to eastern Brazil and has been employed in recent biomedical studies in, for example, reproductive biology, infectious disease and drug development. In particular, marmosets have been used for neuroscience and behavioral studies, such as, pathological studies of Alzheimer's disease, Parkinson's disease, Huntington's disease, Multiple sclerosis and studies of anxiety and stress ^[1].
Common Name: Common marmoset
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
RN18S1^[1]	18S ribosomal RNA	Thyroid,thymus, heart Lung, liver, adrenal Gland, kidney, spleen stomach Small intestine, colon and muscle	AB571241	F:CGCGGTTCTATTTTGTTGGT R:AGTCGGGCATCGTTTATGGTC	219	62	SYBR
RPLP0^[1]	Ribosomal protien,large, PO	Thyroid,thymus, heart Lung, liver, adrenal Gland, kidney, spleen stomach Small intestine, colon and muscle	XM_002753074	F:GCTCAACATCTCTCCCTTCTCCT R:GCTCAACATCTCTCCCTTCTCCT	140	60	SYBR
ACTB^[1]	b-Actin	Brain areas (cerebral cortex, striatum, hippocampus, thalamus and cerebellum)	DD279463	F:AGCAGTCGGTTGGAGCGAGCAT R:TGGCTTTTGGGAGGGCAAGGGA	139	62	SYBR
PPIA^[1]	Peptidylprolyl isomerace (Cyclophilin) A	Brain areas (cerebral cortex, striatum, hippocampus, thalamus and cerebellum)	ENSCJAT00000023248	F:TGCTGGACCCAACAGAAACGGT R:AAAGCGCTCCATGGCCTCCA	130	60	SYBR

Name: Hiroshi Kitamura
Email: ktmr@med.nagoya-cu.ac.jp
Institution: Department of Comparative and Experimental Medicine, Graduate School of Medical Sciences, Nagoya City University, Kawasumi 1, Mizuho-cho, Mizuho-ku, Nagoya 467-8601, Japan

Cited by 6(Based on Google Scholar [2017-08-10])

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 Shimamoto Y, Kitamura H, Niimi K, Yoshikawa Y, Hoshi F, Ishizuka M, Takahashi E. Selection of suitable reference genes for mRNA quantification studies using common marmoset tissues. Mol Biol Rep. 2013 Dec;40(12):6747-55. doi: 10.1007/s11033-013-2791-0. Epub 2013 Sep 26. PubMed PMID: 24068436.

@@ Line 83: / Line 83: @@
 *'''Name''': Hiroshi Kitamura
 *'''Email''': ktmr@med.nagoya-cu.ac.jp
-*'''Institute''': Department of Comparative and Experimental Medicine, Graduate School of Medical Sciences, Nagoya City University, Kawasumi 1, Mizuho-cho, Mizuho-ku, Nagoya 467-8601, Japan
+*'''Institution''': Department of Comparative and Experimental Medicine, Graduate School of Medical Sciences, Nagoya City University, Kawasumi 1, Mizuho-cho, Mizuho-ku, Nagoya 467-8601, Japan
 ===Citation Statistics===
 Cited by '''6'''(Based on Google Scholar [2017-08-10])