Difference between revisions of "Camellia sinensis"

From ICG
Jump to navigation Jump to search
Line 1: Line 1:
 
==Description==
 
==Description==
 
[[File:REFqPCR2014012-1.jpg|right|327px|]]
 
[[File:REFqPCR2014012-1.jpg|right|327px|]]
* Tea is the most consumed beverage in the world aside from water, and has many beneficial health effects. Tea plant (Camellia sinensis), is an important cash crop, and is grown commercially in about 30 different countries.
+
* '''''Tea (Camellia sinensis)''''' is the most consumed beverage in the world aside from water, and has many beneficial health effects. It is an important cash crop, and is grown commercially in about 30 different countries.
 
* Green tea is manufactured by drying fresh tea leaves. It contains characteristic polyphenolic compounds, (–)-epigallocatechin-3-gallate (EGCG),3 (–)-epigallocatechin (EGC), (–)-epicatechin-3-gallate (ECG) and (–)-epicatechin (EC). These compounds are commonly known as catechins.  
 
* Green tea is manufactured by drying fresh tea leaves. It contains characteristic polyphenolic compounds, (–)-epigallocatechin-3-gallate (EGCG),3 (–)-epigallocatechin (EGC), (–)-epicatechin-3-gallate (ECG) and (–)-epicatechin (EC). These compounds are commonly known as catechins.  
 
* A typical tea beverage, prepared in a proportion of 1 g leaf to 100 mL water in a 3-min brew, usually contains 250–350 mg tea solids, comprised of 30–42% catechins and 3–6% caffeine. <ref name="ref1"/> <ref name="ref2"/>.
 
* A typical tea beverage, prepared in a proportion of 1 g leaf to 100 mL water in a 3-min brew, usually contains 250–350 mg tea solids, comprised of 30–42% catechins and 3–6% caffeine. <ref name="ref1"/> <ref name="ref2"/>.

Revision as of 06:33, 25 June 2017

Description

REFqPCR2014012-1.jpg
  • Tea (Camellia sinensis) is the most consumed beverage in the world aside from water, and has many beneficial health effects. It is an important cash crop, and is grown commercially in about 30 different countries.
  • Green tea is manufactured by drying fresh tea leaves. It contains characteristic polyphenolic compounds, (–)-epigallocatechin-3-gallate (EGCG),3 (–)-epigallocatechin (EGC), (–)-epicatechin-3-gallate (ECG) and (–)-epicatechin (EC). These compounds are commonly known as catechins.
  • A typical tea beverage, prepared in a proportion of 1 g leaf to 100 mL water in a 3-min brew, usually contains 250–350 mg tea solids, comprised of 30–42% catechins and 3–6% caffeine. [1] [2].

Various Experimental Treatments

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
CsPTB1[1] Polypyrimidine tract-binding protein
  • Universal reference gene
GAAC01052498.1
  • F:TGACCAAGCACACTCCACACTATCG
  • R:TGCCCCCTTATCATCATCCACAA
107 60 SYBR
CsEF1[1] Elongation factor 1 alpha
  • Universal reference gene
KA280301.1
  • F:TTGGACAAGCTCAAGGCTGAACG
  • R:ATGGCCAGGAGCATCAATGACAGT
110 60 SYBR
CsSAND1[1] SAND family protein
  • Universal reference gene
KM057790
  • F:TCCAATTGCCCCCTTAATGACTCA
  • R:GTAAGGGCAGGCAAACACCAGGTA
109 60 SYBR
CsCLATHRIN1[1] Clathrin adaptor complex subunit
  • Universal reference gene
KA291473.1
  • F:TAGAGCGGGTAGTGGAGACCTCGTT
  • R:TACCAAAGCCGGCTCGTATGAGATT
129 60 SYBR
CsUBC1[1] Ubiquitin-conjugating enzyme
  • Universal reference gene
KA281185.1
  • F:TGCTGGTGGGGTTTTTCTTGTTACC
  • R:AAGGCATATGCTCCCATTGCTGTTT
124 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Bin Xiao
  • Email: xiaobin2093@sohu.com
  • Institution: College of Horticulture, Northwest A&F University, Yangling 712100, Shaanxi, China

Citation Statistics

Cited by 31 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Hao X, Horvath DP, Chao WS, et al. (2014) Identification and evaluation of reliable reference genes for quantitative real-time PCR analysis in tea plant (Camellia sinensis (L.) O. Kuntze). Int J Mol Sci 15, 22155-22172.
  2. Yang CS, Landau JM (2000) Effects of tea consumption on nutrition and health. Journal of Nutrition 130, 2409-2412.