Difference between revisions of "Camellia sinensis"
Jump to navigation
Jump to search
Wangzhennan (talk | contribs) |
Wangzhennan (talk | contribs) |
||
Line 159: | Line 159: | ||
=='''''Biotic Stress & Hormonal Treatment'''''== | =='''''Biotic Stress & Hormonal Treatment'''''== | ||
+ | ===Reference Genes=== | ||
+ | {|class="wikitable sortable" style="font-size:10pt; width:100%" | ||
+ | |- | ||
+ | ! Gene Symbol | ||
+ | ! Gene Name | ||
+ | ! style="width=25% font-size:9pt "|Application Scope | ||
+ | ! Accession Number | ||
+ | ! Primers (5'-3')<br>[Forward/Reverse] | ||
+ | ! Size [bp] | ||
+ | ! Tm [℃] | ||
+ | ! Detection | ||
+ | |- | ||
+ | |align="center"| miR159a<ref name="ref4"/> | ||
+ | |align="center"| miR159a | ||
+ | | | ||
+ | * Bud to the fifth leaf | ||
+ | *Methyl jasmonate (MeJA) Treatment | ||
+ | * Salicylic acid (SA) Treatment | ||
+ | *Abscisic acid (ABA) | ||
+ | |align="center"| NA | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:CGCGCTTGGATTGAAGGG | ||
+ | * R:NA | ||
+ | |align="center"| NA | ||
+ | |align="center"| 60 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| 5S rRNA<ref name="ref4"/> | ||
+ | |align="center"| 5S rRNA | ||
+ | | | ||
+ | *Different organs | ||
+ | |align="center"| NA | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:GCGATCATACCAGCACCAATG | ||
+ | * R:CAACACAAGGACTTCCTAGGG | ||
+ | |align="center"| NA | ||
+ | |align="center"| 60 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| miR6149<ref name="ref4"/> | ||
+ | |align="center"| miR6149 | ||
+ | | | ||
+ | *Leaves were attacked by Ectropis oblique and U4 | ||
+ | |align="center"| NA | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:GCGCGATACGCACCTGAAT | ||
+ | * R:NA | ||
+ | |align="center"| NA | ||
+ | |align="center"| 60 | ||
+ | |align="center"| SYBR | ||
+ | |- | ||
+ | |align="center"| miR5368n<ref name="ref4"/> | ||
+ | |align="center"| miR5368n | ||
+ | | | ||
+ | *Methyl jasmonate (MeJA) Treatment | ||
+ | * Salicylic acid (SA) Treatment | ||
+ | * Abscisic acid (ABA) Treatment | ||
+ | |align="center"| NA | ||
+ | |nowrap style="font-size:9pt"| | ||
+ | * F:GCGGAGATACCACTCTGG | ||
+ | * R:NA | ||
+ | |align="center"| NA | ||
+ | |align="center"| 60 | ||
+ | |align="center"| SYBR | ||
+ | |} | ||
+ | ===Moleculer Type=== | ||
+ | * miRNA | ||
+ | ===Evaluation Methods=== | ||
+ | * [https://genorm.cmgg.be/ '''geNorm method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference'''] | ||
+ | * [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference'''] | ||
+ | ===Contact=== | ||
+ | *'''Name''': Chaoling Wei | ||
+ | *'''Email''': weichl@ahau.edu.cn; | ||
+ | *'''Institution''': State Key Laboratory of Tea Plant Biology and Utilization, Anhui Agricultural University, 130 Changjiang West Road, Hefei 230036, China | ||
=='''References'''== | =='''References'''== |
Revision as of 04:28, 22 July 2017
Contents
Description
- Camellia sinensis is the most consumed beverage in the world aside from water, and has many beneficial health effects. It is an important cash crop, and is grown commercially in about 30 different countries. It is manufactured by drying fresh tea leaves and contains characteristic polyphenolic compounds, (–)-epigallocatechin-3-gallate (EGCG), (–)-epigallocatechin (EGC), (–)-epicatechin-3-gallate (ECG) and (–)-epicatechin (EC). These compounds are commonly known as catechins[1][2].
- Common Name: Green tea
- NCBI Taxonomy
Various Experimental Treatments
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
CsPTB1[1] | Polypyrimidine tract-binding protein |
|
GAAC01052498.1 |
|
107 | 60 | SYBR |
CsEF1[1] | Elongation factor 1 alpha |
|
KA280301.1 |
|
110 | 60 | SYBR |
CsSAND1[1] | SAND family protein |
|
KM057790 |
|
109 | 60 | SYBR |
CsCLATHRIN1[1] | Clathrin adaptor complex subunit |
|
KA291473.1 |
|
129 | 60 | SYBR |
CsUBC1[1] | Ubiquitin-conjugating enzyme |
|
KA281185.1 |
|
124 | 60 | SYBR |
Molecular Types
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
- ΔCt approach method && Related Reference
Contact
- Name: Bin Xiao
- Email: xiaobin2093@sohu.com
- Institution: College of Horticulture, Northwest A&F University, Yangling 712100, Shaanxi, China
Citation Statistics
Cited by 31 (Based on Google Scholar [2017-06-16])
Leaf development & Hormonal Treatment
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
CsTBP[3] | TATA-box binding protein gene |
|
AT5G09810 (Arabidopsis homolog gene) |
|
166 | 85 | SYBR |
CsTIP41[3] | Tap42-interacting protein of 41 kDa gene |
|
AT4G34270 (Arabidopsis homolog gene) |
|
176 | 87 | SYBR |
Moleculer Type
- mRNA
Evaluation Methods
- geNorm method && Related Reference
- NormFinder method && Related Reference
- BestKeeper method && Related Reference
Contact
- Name: Jing Zhuang
- Email: zhuangjing@njau.edu.cn
- Institution: Tea Science Research Institute, College of Horticulture, Nanjing Agricultural University, Nanjing, 210095, China
Citation Statistics
Cited by 31 (Based on Google Scholar [2017-06-16])
Biotic Stress & Hormonal Treatment
Reference Genes
Gene Symbol | Gene Name | Application Scope | Accession Number | Primers (5'-3') [Forward/Reverse] |
Size [bp] | Tm [℃] | Detection |
---|---|---|---|---|---|---|---|
miR159a[4] | miR159a |
|
NA |
|
NA | 60 | SYBR |
5S rRNA[4] | 5S rRNA |
|
NA |
|
NA | 60 | SYBR |
miR6149[4] | miR6149 |
|
NA |
|
NA | 60 | SYBR |
miR5368n[4] | miR5368n |
|
NA |
|
NA | 60 | SYBR |
Moleculer Type
- miRNA
Evaluation Methods
Contact
- Name: Chaoling Wei
- Email: weichl@ahau.edu.cn;
- Institution: State Key Laboratory of Tea Plant Biology and Utilization, Anhui Agricultural University, 130 Changjiang West Road, Hefei 230036, China
References
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 Hao X, Horvath DP, Chao WS, et al. (2014) Identification and evaluation of reliable reference genes for quantitative real-time PCR analysis in tea plant (Camellia sinensis (L.) O. Kuntze). Int J Mol Sci 15, 22155-22172.
- ↑ Yang CS, Landau JM (2000) Effects of tea consumption on nutrition and health. Journal of Nutrition 130, 2409-2412.
- ↑ 3.0 3.1 Wu, Zhi-Jun, et al. "Selection of suitable reference genes for qRT-PCR normalization during leaf development and hormonal stimuli in tea plant (Camellia sinensis)." Scientific reports 6 (2016).
- ↑ 4.0 4.1 4.2 4.3 Cite error: Invalid
<ref>
tag; no text was provided for refs namedref4