Difference between revisions of "Camellia sinensis"

From ICG
Jump to navigation Jump to search
 
(32 intermediate revisions by 9 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
−
[[File:REFqPCR2014012-1.jpg|right|327px|]]
+
[[File:Camellia sinensis.png|right|200px|link=Camellia sinensis]]
−
* Tea is the most consumed beverage in the world aside from water, and has many beneficial health effects. Tea plant (Camellia sinensis), is an important cash crop, and is grown commercially in about 30 different countries.
+
* '''''Camellia sinensis''''' is the most consumed beverage in the world aside from water, and has many beneficial health effects. It is an important cash crop, and is grown commercially in about 30 different countries. It is manufactured by drying fresh tea leaves and contains characteristic polyphenolic compounds, (–)-epigallocatechin-3-gallate (EGCG), (–)-epigallocatechin (EGC), (–)-epicatechin-3-gallate (ECG) and (–)-epicatechin (EC). These compounds are commonly known as catechins<ref name="ref1"/><ref name="ref2"/>.  
−
* Green tea is manufactured by drying fresh tea leaves. It contains characteristic polyphenolic compounds, (–)-epigallocatechin-3-gallate (EGCG),3 (–)-epigallocatechin (EGC), (–)-epicatechin-3-gallate (ECG) and (–)-epicatechin (EC). These compounds are commonly known as catechins.
+
* <font color=blue>'''Common Name:'''</font> '''Green tea'''
−
* A typical tea beverage, prepared in a proportion of 1 g leaf to 100 mL water in a 3-min brew, usually contains 250–350 mg tea solids, comprised of 30–42% catechins and 3–6% caffeine. <ref name="ref1"/> <ref name="ref2"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=4442 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Various Experimental Treatments'''''==
 
=='''''Various Experimental Treatments'''''==
−
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 21: Line 21:
 
|align="center"| Polypyrimidine tract-binding protein  
 
|align="center"| Polypyrimidine tract-binding protein  
 
|
 
|
−
* Universal reference gene
+
* Sampled at different time of a day
 +
* Leaves, whole flowers at half boom, shoots, five-month-old stems, axillary buds and roots
 +
* Cold treatment
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GAAC01052498.1 '''GAAC01052498.1''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nucest/GAAC01052498.1 '''GAAC01052498.1''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 33: Line 35:
 
|align="center"| Elongation factor 1 alpha
 
|align="center"| Elongation factor 1 alpha
 
|
 
|
−
* Universal reference gene
+
* Sampled at different time of a day
 +
* Leaves, whole flowers at half boom, shoots, five-month-old stems, axillary buds and roots
 +
* Cold treatment
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KA280301.1 '''KA280301.1''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KA280301.1 '''KA280301.1''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 45: Line 49:
 
|align="center"| SAND family protein
 
|align="center"| SAND family protein
 
|
 
|
−
* Universal reference gene
+
* Sampled at different time of a day
 +
* Leaves, whole flowers at half boom, shoots, five-month-old stems, axillary buds and roots
 +
* Cold treatment
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KM057790.1 '''KM057790''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KM057790.1 '''KM057790''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 57: Line 63:
 
|align="center"| Clathrin adaptor complex subunit  
 
|align="center"| Clathrin adaptor complex subunit  
 
|
 
|
−
* Universal reference gene
+
* Sampled at different time of a day
 +
* Leaves, whole flowers at half boom, shoots, five-month-old stems, axillary buds and roots
 +
* Cold treatment
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KA291473.1 '''KA291473.1''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KA291473.1 '''KA291473.1''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 69: Line 77:
 
|align="center"| Ubiquitin-conjugating enzyme  
 
|align="center"| Ubiquitin-conjugating enzyme  
 
|
 
|
−
* Universal reference gene
+
* Sampled at different time of a day
 +
* Leaves, whole flowers at half boom, shoots, five-month-old stems, axillary buds and roots
 +
* Cold treatment
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KA281185.1 '''KA281185.1''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KA281185.1 '''KA281185.1''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 79: Line 89:
 
|}
 
|}
  
−
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 93: Line 104:
  
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''31''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=1068678776572222399&as_sdt=2005&sciodt=0,5&hl=en '''31'''] (Based on Google Scholar [2017-09-01])
 +
 
 +
=='''''Leaf development & Hormonal Treatment'''''==
 +
===Internal Control Genes===
 +
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 +
|-
 +
! Gene Symbol 
 +
! Gene Name
 +
! style="width=25%　font-size:9pt　"|Application Scope
 +
! Accession Number
 +
! Primers (5'-3')<br>[Forward/Reverse]
 +
! Size [bp]
 +
! Tm [℃]
 +
! Detection
 +
|-
 +
|align="center"| CsTBP<ref name="ref3"/>
 +
|align="center"| TATA-box binding protein gene
 +
|
 +
*Leaf development and metabolism
 +
*Hormonal stimuli
 +
|align="center"| [https://www.arabidopsis.org/servlets/TairObject?id=135194&type=locus ''' AT5G09810'''] (Arabidopsis homolog gene)
 +
|nowrap style="font-size:9pt"|
 +
* F:GGCGGATCAAGTGTTGGAAGGGAG
 +
* R:ACGCTTGGGATTGTATTCGGCATTA
 +
|align="center"| 166
 +
|align="center"| 85
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| CsTIP41<ref name="ref3"/>
 +
|align="center"| Tap42-interacting protein of 41 kDa gene
 +
|
 +
*Leaf development and metabolism
 +
|align="center"| [https://www.arabidopsis.org/servlets/TairObject?id=126761&type=locus ''' AT4G34270'''] (Arabidopsis homolog gene)
 +
|nowrap style="font-size:9pt"|
 +
* F:TGGAGTTGGAAGTGGACGAGACCGA
 +
* R:CTCTGGAAAGTGGGATGTTTGAAGC
 +
|align="center"| 176
 +
|align="center"| 87
 +
|align="center"| SYBR
 +
|}
 +
 
 +
===Molecular Types===
 +
* mRNA
 +
 
 +
===Evaluation Methods===
 +
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 +
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 +
* [http://www.gene-quantification.com/bestkeeper.html '''BestKeeper method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15127793 '''Related Reference''']
 +
===Contact===
 +
*'''Name''': Jing Zhuang
 +
*'''Email''': zhuangjing@njau.edu.cn
 +
*'''Institution''': Tea Science Research Institute, College of Horticulture, Nanjing Agricultural University, Nanjing, 210095, China
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=8778229070868776757&as_sdt=2005&sciodt=0,5&hl=en '''18'''] (Based on Google Scholar [2017-09-01])
 +
 
 +
=='''''Biotic Stress & Hormonal Treatment'''''==
 +
===Internal Control Genes===
 +
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 +
|-
 +
! Gene Symbol 
 +
! Gene Name
 +
! style="width=25%　font-size:9pt　"|Application Scope
 +
! Accession Number
 +
! Primers (5'-3')<br>[Forward/Reverse]
 +
! Size [bp]
 +
! Tm [℃]
 +
! Detection
 +
|-
 +
|align="center"| miR159a<ref name="ref4"/>
 +
|align="center"| miR159a
 +
|
 +
* Bud to the fifth leaf
 +
*Methyl jasmonate (MeJA) Treatment
 +
* Salicylic acid (SA) Treatment
 +
*Abscisic acid (ABA)
 +
|align="center"| NA
 +
|nowrap style="font-size:9pt"|
 +
* F:CGCGCTTGGATTGAAGGG
 +
* R:NA
 +
|align="center"| NA
 +
|align="center"| 60
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| 5S rRNA<ref name="ref4"/>
 +
|align="center"|  5S rRNA
 +
|
 +
*Different organs
 +
|align="center"| NA
 +
|nowrap style="font-size:9pt"|
 +
* F:GCGATCATACCAGCACCAATG
 +
* R:CAACACAAGGACTTCCTAGGG
 +
|align="center"| NA
 +
|align="center"| 60
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| miR6149<ref name="ref4"/>
 +
|align="center"| miR6149
 +
|
 +
*Leaves were attacked by Ectropis oblique and U4
 +
|align="center"| NA
 +
|nowrap style="font-size:9pt"|
 +
* F:GCGCGATACGCACCTGAAT
 +
* R:NA
 +
|align="center"| NA
 +
|align="center"| 60
 +
|align="center"| SYBR
 +
|-
 +
|align="center"| miR5368n<ref name="ref4"/>
 +
|align="center"| miR5368n
 +
|
 +
*Methyl jasmonate (MeJA) Treatment
 +
* Salicylic acid (SA) Treatment
 +
* Abscisic acid (ABA) Treatment
 +
|align="center"| NA
 +
|nowrap style="font-size:9pt"|
 +
* F:GCGGAGATACCACTCTGG
 +
* R:NA
 +
|align="center"| NA
 +
|align="center"| 60
 +
|align="center"| SYBR
 +
|}
 +
===Molecular Types===
 +
* miRNA
 +
 
 +
===Evaluation Methods===
 +
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 +
* [https://moma.dk/normfinder-software '''NormFinder method'''] && [https://www.ncbi.nlm.nih.gov/pubmed/15289330 '''Related Reference''']
 +
===Contact===
 +
*'''Name''': Chaoling Wei
 +
*'''Email''': weichl@ahau.edu.cn;
 +
*'''Institution''': State Key Laboratory of Tea Plant Biology and Utilization, Anhui Agricultural University, 130 Changjiang West Road, Hefei 230036, China
 +
===Citation Statistics===
 +
Cited by [https://scholar.google.com/scholar?cites=4634984645310928040&as_sdt=2005&sciodt=0,5&hl=en '''3'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>
 
<ref name="ref1">
 
<ref name="ref1">
−
Hao X, Horvath DP, Chao WS, et al. (2014) Identification and evaluation of reliable reference genes for quantitative real-time PCR analysis in tea plant (Camellia sinensis (L.) O. Kuntze). Int J Mol Sci 15, 22155-22172.
+
Hao X, Horvath D P, Chao W S, et al. Identification and evaluation of reliable reference genes for quantitative real-time PCR analysis in tea plant (Camellia sinensis (L.) O. Kuntze)[J]. International journal of molecular sciences, 2014, 15(12): 22155-22172.
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
−
Yang CS, Landau JM (2000) Effects of tea consumption on nutrition and health. Journal of Nutrition 130, 2409-2412.
+
Yang C S, Landau J M. Effects of tea consumption on nutrition and health[J]. The Journal of nutrition, 2000, 130(10): 2409-2412.
 +
</ref>
 +
<ref name="ref3">
 +
Wu Z J, Tian C, Jiang Q, et al. Selection of suitable reference genes for qRT-PCR normalization during leaf development and hormonal stimuli in tea plant (Camellia sinensis)[J]. Scientific reports, 2016, 6.
 +
</ref>
 +
<ref name="ref4">
 +
Song H, Zhang X, Shi C, et al. Selection and verification of candidate reference genes for mature microRNA expression by quantitative RT-PCR in the tea plant (Camellia sinensis)[J]. Genes, 2016, 7(6): 25.
 
</ref>
 
</ref>
 
</references>
 
</references>
−
[[Category:Plants]]　[[Category:mRNA]]
+
 
 +
=='''Categories'''==
 +
[[Category:Plants]][[Category:mRNA]]
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 
[[Category:CACS]] [[Category:EF1α]] [[Category:PTB]] [[Category:SAND]] [[Category:Ubiquitin]]
 
[[Category:CACS]] [[Category:EF1α]] [[Category:PTB]] [[Category:SAND]] [[Category:Ubiquitin]]
 +
[[Category:Hormone Treatment]] [[Category:Different Tissues]] [[Category:Abiotic Stress]] [[Category:Cold Treatment]] [[Category:Different Developmental Stages]]
 +
[[Category:TBP]] [[Category:TIP41]] [[Category:non-coding RNA]]
 +
[[Category:Small RNAs]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
[[Category:Delta Ct]]

Latest revision as of 08:56, 1 September 2017

Description

Camellia sinensis.png
  • Camellia sinensis is the most consumed beverage in the world aside from water, and has many beneficial health effects. It is an important cash crop, and is grown commercially in about 30 different countries. It is manufactured by drying fresh tea leaves and contains characteristic polyphenolic compounds, (–)-epigallocatechin-3-gallate (EGCG), (–)-epigallocatechin (EGC), (–)-epicatechin-3-gallate (ECG) and (–)-epicatechin (EC). These compounds are commonly known as catechins[1][2].
  • Common Name: Green tea
  • NCBI Taxonomy

Various Experimental Treatments

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
CsPTB1[1] Polypyrimidine tract-binding protein
  • Sampled at different time of a day
  • Leaves, whole flowers at half boom, shoots, five-month-old stems, axillary buds and roots
  • Cold treatment
 GAAC01052498.1
  • F:TGACCAAGCACACTCCACACTATCG
  • R:TGCCCCCTTATCATCATCCACAA
 107 60 SYBR
CsEF1[1] Elongation factor 1 alpha
  • Sampled at different time of a day
  • Leaves, whole flowers at half boom, shoots, five-month-old stems, axillary buds and roots
  • Cold treatment
 KA280301.1
  • F:TTGGACAAGCTCAAGGCTGAACG
  • R:ATGGCCAGGAGCATCAATGACAGT
 110 60 SYBR
CsSAND1[1] SAND family protein
  • Sampled at different time of a day
  • Leaves, whole flowers at half boom, shoots, five-month-old stems, axillary buds and roots
  • Cold treatment
 KM057790
  • F:TCCAATTGCCCCCTTAATGACTCA
  • R:GTAAGGGCAGGCAAACACCAGGTA
 109 60 SYBR
CsCLATHRIN1[1] Clathrin adaptor complex subunit
  • Sampled at different time of a day
  • Leaves, whole flowers at half boom, shoots, five-month-old stems, axillary buds and roots
  • Cold treatment
 KA291473.1
  • F:TAGAGCGGGTAGTGGAGACCTCGTT
  • R:TACCAAAGCCGGCTCGTATGAGATT
 129 60 SYBR
CsUBC1[1] Ubiquitin-conjugating enzyme
  • Sampled at different time of a day
  • Leaves, whole flowers at half boom, shoots, five-month-old stems, axillary buds and roots
  • Cold treatment
 KA281185.1
  • F:TGCTGGTGGGGTTTTTCTTGTTACC
  • R:AAGGCATATGCTCCCATTGCTGTTT
 124 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Bin Xiao
  • Email: xiaobin2093@sohu.com
  • Institution: College of Horticulture, Northwest A&F University, Yangling 712100, Shaanxi, China

Citation Statistics

Cited by 31 (Based on Google Scholar [2017-09-01])

Leaf development & Hormonal Treatment

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
CsTBP[3] TATA-box binding protein gene
  • Leaf development and metabolism
  • Hormonal stimuli
 AT5G09810 (Arabidopsis homolog gene)
  • F:GGCGGATCAAGTGTTGGAAGGGAG
  • R:ACGCTTGGGATTGTATTCGGCATTA
 166 85 SYBR
CsTIP41[3] Tap42-interacting protein of 41 kDa gene
  • Leaf development and metabolism
 AT4G34270 (Arabidopsis homolog gene)
  • F:TGGAGTTGGAAGTGGACGAGACCGA
  • R:CTCTGGAAAGTGGGATGTTTGAAGC
 176 87 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jing Zhuang
  • Email: zhuangjing@njau.edu.cn
  • Institution: Tea Science Research Institute, College of Horticulture, Nanjing Agricultural University, Nanjing, 210095, China

Citation Statistics

Cited by 18 (Based on Google Scholar [2017-09-01])

Biotic Stress & Hormonal Treatment

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
miR159a[4] miR159a
  • Bud to the fifth leaf
  • Methyl jasmonate (MeJA) Treatment
  • Salicylic acid (SA) Treatment
  • Abscisic acid (ABA)
 NA
  • F:CGCGCTTGGATTGAAGGG
  • R:NA
 NA 60 SYBR
5S rRNA[4] 5S rRNA
  • Different organs
 NA
  • F:GCGATCATACCAGCACCAATG
  • R:CAACACAAGGACTTCCTAGGG
 NA 60 SYBR
miR6149[4] miR6149
  • Leaves were attacked by Ectropis oblique and U4
 NA
  • F:GCGCGATACGCACCTGAAT
  • R:NA
 NA 60 SYBR
miR5368n[4] miR5368n
  • Methyl jasmonate (MeJA) Treatment
  • Salicylic acid (SA) Treatment
  • Abscisic acid (ABA) Treatment
 NA
  • F:GCGGAGATACCACTCTGG
  • R:NA
 NA 60 SYBR

Molecular Types

  • miRNA

Evaluation Methods

Contact

  • Name: Chaoling Wei
  • Email: weichl@ahau.edu.cn;
  • Institution: State Key Laboratory of Tea Plant Biology and Utilization, Anhui Agricultural University, 130 Changjiang West Road, Hefei 230036, China

Citation Statistics

Cited by 3 (Based on Google Scholar [2017-09-01])

References

  1. ↑ 1.0 1.1 1.2 1.3 1.4 1.5 Hao X, Horvath D P, Chao W S, et al. Identification and evaluation of reliable reference genes for quantitative real-time PCR analysis in tea plant (Camellia sinensis (L.) O. Kuntze)[J]. International journal of molecular sciences, 2014, 15(12): 22155-22172.
  2. ↑ Yang C S, Landau J M. Effects of tea consumption on nutrition and health[J]. The Journal of nutrition, 2000, 130(10): 2409-2412.
  3. ↑ 3.0 3.1 Wu Z J, Tian C, Jiang Q, et al. Selection of suitable reference genes for qRT-PCR normalization during leaf development and hormonal stimuli in tea plant (Camellia sinensis)[J]. Scientific reports, 2016, 6.
  4. ↑ 4.0 4.1 4.2 4.3 Song H, Zhang X, Shi C, et al. Selection and verification of candidate reference genes for mature microRNA expression by quantitative RT-PCR in the tea plant (Camellia sinensis)[J]. Genes, 2016, 7(6): 25.

Categories

Retrieved from "http://192.168.164.12:9052/index.php?title=Camellia_sinensis&oldid=8818"