Difference between revisions of "Camellia sinensis"

From ICG
Jump to navigation Jump to search
 
(6 intermediate revisions by 4 users not shown)
Line 104: Line 104:
  
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''31''' (Based on Google Scholar [2017-08-10])
+
Cited by [https://scholar.google.com/scholar?cites=1068678776572222399&as_sdt=2005&sciodt=0,5&hl=en '''31'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Leaf development & Hormonal Treatment'''''==
 
=='''''Leaf development & Hormonal Treatment'''''==
Line 145: Line 145:
 
|}
 
|}
  
−
===Moleculer Type===
+
===Molecular Types===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 156: Line 157:
 
*'''Institution''': Tea Science Research Institute, College of Horticulture, Nanjing Agricultural University, Nanjing, 210095, China
 
*'''Institution''': Tea Science Research Institute, College of Horticulture, Nanjing Agricultural University, Nanjing, 210095, China
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''18''' (Based on Google Scholar [2017-08-10])
+
Cited by [https://scholar.google.com/scholar?cites=8778229070868776757&as_sdt=2005&sciodt=0,5&hl=en '''18'''] (Based on Google Scholar [2017-09-01])
  
 
=='''''Biotic Stress & Hormonal Treatment'''''==
 
=='''''Biotic Stress & Hormonal Treatment'''''==
Line 224: Line 225:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
−
===Moleculer Type===
+
===Molecular Types===
 
* miRNA
 
* miRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 234: Line 236:
 
*'''Institution''': State Key Laboratory of Tea Plant Biology and Utilization, Anhui Agricultural University, 130 Changjiang West Road, Hefei 230036, China
 
*'''Institution''': State Key Laboratory of Tea Plant Biology and Utilization, Anhui Agricultural University, 130 Changjiang West Road, Hefei 230036, China
 
===Citation Statistics===
 
===Citation Statistics===
−
Cited by '''31''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=4634984645310928040&as_sdt=2005&sciodt=0,5&hl=en '''3'''] (Based on Google Scholar [2017-09-01])
 +
 
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>
 
<ref name="ref1">
 
<ref name="ref1">
−
Hao X, Horvath DP, Chao WS, et al. (2014) Identification and evaluation of reliable reference genes for quantitative real-time PCR analysis in tea plant (Camellia sinensis (L.) O. Kuntze). Int J Mol Sci 15, 22155-22172.
+
Hao X, Horvath D P, Chao W S, et al. Identification and evaluation of reliable reference genes for quantitative real-time PCR analysis in tea plant (Camellia sinensis (L.) O. Kuntze)[J]. International journal of molecular sciences, 2014, 15(12): 22155-22172.
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
−
Yang CS, Landau JM (2000) Effects of tea consumption on nutrition and health. Journal of Nutrition 130, 2409-2412.
+
Yang C S, Landau J M. Effects of tea consumption on nutrition and health[J]. The Journal of nutrition, 2000, 130(10): 2409-2412.
 
</ref>
 
</ref>
 
<ref name="ref3">
 
<ref name="ref3">
−
Wu, Zhi-Jun, et al. "Selection of suitable reference genes for qRT-PCR normalization during leaf development and hormonal stimuli in tea plant (Camellia sinensis)." Scientific reports 6 (2016).
+
Wu Z J, Tian C, Jiang Q, et al. Selection of suitable reference genes for qRT-PCR normalization during leaf development and hormonal stimuli in tea plant (Camellia sinensis)[J]. Scientific reports, 2016, 6.
 
</ref>
 
</ref>
 
<ref name="ref4">
 
<ref name="ref4">
−
Song, Hui, et al. "Selection and verification of candidate reference genes for mature microRNA expression by quantitative RT-PCR in the tea plant (Camellia sinensis)." Genes 7.6 (2016): 25.
+
Song H, Zhang X, Shi C, et al. Selection and verification of candidate reference genes for mature microRNA expression by quantitative RT-PCR in the tea plant (Camellia sinensis)[J]. Genes, 2016, 7(6): 25.
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 
=='''Categories'''==
 
=='''Categories'''==
 
[[Category:Plants]][[Category:mRNA]]
 
[[Category:Plants]][[Category:mRNA]]

Latest revision as of 08:56, 1 September 2017

Description

Camellia sinensis.png
  • Camellia sinensis is the most consumed beverage in the world aside from water, and has many beneficial health effects. It is an important cash crop, and is grown commercially in about 30 different countries. It is manufactured by drying fresh tea leaves and contains characteristic polyphenolic compounds, (–)-epigallocatechin-3-gallate (EGCG), (–)-epigallocatechin (EGC), (–)-epicatechin-3-gallate (ECG) and (–)-epicatechin (EC). These compounds are commonly known as catechins[1][2].
  • Common Name: Green tea
  • NCBI Taxonomy

Various Experimental Treatments

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
CsPTB1[1] Polypyrimidine tract-binding protein
  • Sampled at different time of a day
  • Leaves, whole flowers at half boom, shoots, five-month-old stems, axillary buds and roots
  • Cold treatment
 GAAC01052498.1
  • F:TGACCAAGCACACTCCACACTATCG
  • R:TGCCCCCTTATCATCATCCACAA
 107 60 SYBR
CsEF1[1] Elongation factor 1 alpha
  • Sampled at different time of a day
  • Leaves, whole flowers at half boom, shoots, five-month-old stems, axillary buds and roots
  • Cold treatment
 KA280301.1
  • F:TTGGACAAGCTCAAGGCTGAACG
  • R:ATGGCCAGGAGCATCAATGACAGT
 110 60 SYBR
CsSAND1[1] SAND family protein
  • Sampled at different time of a day
  • Leaves, whole flowers at half boom, shoots, five-month-old stems, axillary buds and roots
  • Cold treatment
 KM057790
  • F:TCCAATTGCCCCCTTAATGACTCA
  • R:GTAAGGGCAGGCAAACACCAGGTA
 109 60 SYBR
CsCLATHRIN1[1] Clathrin adaptor complex subunit
  • Sampled at different time of a day
  • Leaves, whole flowers at half boom, shoots, five-month-old stems, axillary buds and roots
  • Cold treatment
 KA291473.1
  • F:TAGAGCGGGTAGTGGAGACCTCGTT
  • R:TACCAAAGCCGGCTCGTATGAGATT
 129 60 SYBR
CsUBC1[1] Ubiquitin-conjugating enzyme
  • Sampled at different time of a day
  • Leaves, whole flowers at half boom, shoots, five-month-old stems, axillary buds and roots
  • Cold treatment
 KA281185.1
  • F:TGCTGGTGGGGTTTTTCTTGTTACC
  • R:AAGGCATATGCTCCCATTGCTGTTT
 124 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Bin Xiao
  • Email: xiaobin2093@sohu.com
  • Institution: College of Horticulture, Northwest A&F University, Yangling 712100, Shaanxi, China

Citation Statistics

Cited by 31 (Based on Google Scholar [2017-09-01])

Leaf development & Hormonal Treatment

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
CsTBP[3] TATA-box binding protein gene
  • Leaf development and metabolism
  • Hormonal stimuli
 AT5G09810 (Arabidopsis homolog gene)
  • F:GGCGGATCAAGTGTTGGAAGGGAG
  • R:ACGCTTGGGATTGTATTCGGCATTA
 166 85 SYBR
CsTIP41[3] Tap42-interacting protein of 41 kDa gene
  • Leaf development and metabolism
 AT4G34270 (Arabidopsis homolog gene)
  • F:TGGAGTTGGAAGTGGACGAGACCGA
  • R:CTCTGGAAAGTGGGATGTTTGAAGC
 176 87 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Jing Zhuang
  • Email: zhuangjing@njau.edu.cn
  • Institution: Tea Science Research Institute, College of Horticulture, Nanjing Agricultural University, Nanjing, 210095, China

Citation Statistics

Cited by 18 (Based on Google Scholar [2017-09-01])

Biotic Stress & Hormonal Treatment

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse] 		Size [bp] Tm [℃] Detection
miR159a[4] miR159a
  • Bud to the fifth leaf
  • Methyl jasmonate (MeJA) Treatment
  • Salicylic acid (SA) Treatment
  • Abscisic acid (ABA)
 NA
  • F:CGCGCTTGGATTGAAGGG
  • R:NA
 NA 60 SYBR
5S rRNA[4] 5S rRNA
  • Different organs
 NA
  • F:GCGATCATACCAGCACCAATG
  • R:CAACACAAGGACTTCCTAGGG
 NA 60 SYBR
miR6149[4] miR6149
  • Leaves were attacked by Ectropis oblique and U4
 NA
  • F:GCGCGATACGCACCTGAAT
  • R:NA
 NA 60 SYBR
miR5368n[4] miR5368n
  • Methyl jasmonate (MeJA) Treatment
  • Salicylic acid (SA) Treatment
  • Abscisic acid (ABA) Treatment
 NA
  • F:GCGGAGATACCACTCTGG
  • R:NA
 NA 60 SYBR

Molecular Types

  • miRNA

Evaluation Methods

Contact

  • Name: Chaoling Wei
  • Email: weichl@ahau.edu.cn;
  • Institution: State Key Laboratory of Tea Plant Biology and Utilization, Anhui Agricultural University, 130 Changjiang West Road, Hefei 230036, China

Citation Statistics

Cited by 3 (Based on Google Scholar [2017-09-01])

References

  1. ↑ 1.0 1.1 1.2 1.3 1.4 1.5 Hao X, Horvath D P, Chao W S, et al. Identification and evaluation of reliable reference genes for quantitative real-time PCR analysis in tea plant (Camellia sinensis (L.) O. Kuntze)[J]. International journal of molecular sciences, 2014, 15(12): 22155-22172.
  2. ↑ Yang C S, Landau J M. Effects of tea consumption on nutrition and health[J]. The Journal of nutrition, 2000, 130(10): 2409-2412.
  3. ↑ 3.0 3.1 Wu Z J, Tian C, Jiang Q, et al. Selection of suitable reference genes for qRT-PCR normalization during leaf development and hormonal stimuli in tea plant (Camellia sinensis)[J]. Scientific reports, 2016, 6.
  4. ↑ 4.0 4.1 4.2 4.3 Song H, Zhang X, Shi C, et al. Selection and verification of candidate reference genes for mature microRNA expression by quantitative RT-PCR in the tea plant (Camellia sinensis)[J]. Genes, 2016, 7(6): 25.

Categories

Retrieved from "http://192.168.164.12:9052/index.php?title=Camellia_sinensis&oldid=8818"