Camellia sinensis

Description

• Camellia sinensis is the most consumed beverage in the world aside from water, and has many beneficial health effects. It is an important cash crop, and is grown commercially in about 30 different countries. It is manufactured by drying fresh tea leaves and contains characteristic polyphenolic compounds, (–)-epigallocatechin-3-gallate (EGCG), (–)-epigallocatechin (EGC), (–)-epicatechin-3-gallate (ECG) and (–)-epicatechin (EC). These compounds are commonly known as catechins.
• Common Name: Green tea
• NCBI Taxonomy

Various Experimental Treatments

Reference Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
CsPTB1	Polypyrimidine tract-binding protein	Sampled at different time of a day Leaves, whole flowers at half boom, shoots, five-month-old stems, axillary buds and roots Cold treatment	GAAC01052498.1	F:TGACCAAGCACACTCCACACTATCG R:TGCCCCCTTATCATCATCCACAA	107	60	SYBR
CsEF1	Elongation factor 1 alpha	Sampled at different time of a day Leaves, whole flowers at half boom, shoots, five-month-old stems, axillary buds and roots Cold treatment	KA280301.1	F:TTGGACAAGCTCAAGGCTGAACG R:ATGGCCAGGAGCATCAATGACAGT	110	60	SYBR
CsSAND1	SAND family protein	Sampled at different time of a day Leaves, whole flowers at half boom, shoots, five-month-old stems, axillary buds and roots Cold treatment	KM057790	F:TCCAATTGCCCCCTTAATGACTCA R:GTAAGGGCAGGCAAACACCAGGTA	109	60	SYBR
CsCLATHRIN1	Clathrin adaptor complex subunit	Sampled at different time of a day Leaves, whole flowers at half boom, shoots, five-month-old stems, axillary buds and roots Cold treatment	KA291473.1	F:TAGAGCGGGTAGTGGAGACCTCGTT R:TACCAAAGCCGGCTCGTATGAGATT	129	60	SYBR
CsUBC1	Ubiquitin-conjugating enzyme	Sampled at different time of a day Leaves, whole flowers at half boom, shoots, five-month-old stems, axillary buds and roots Cold treatment	KA281185.1	F:TGCTGGTGGGGTTTTTCTTGTTACC R:AAGGCATATGCTCCCATTGCTGTTT	124	60	SYBR

Molecular Types

• mRNA

Evaluation Methods

• geNorm method && Related Reference
• NormFinder method && Related Reference
• BestKeeper method && Related Reference
• ΔCt approach method && Related Reference

Contact

• Name: Bin Xiao
• Email: xiaobin2093@sohu.com
• Institution: College of Horticulture, Northwest A&F University, Yangling 712100, Shaanxi, China

Citation Statistics

Cited by 31 (Based on Google Scholar [2017-06-16])

Leaf development & Hormonal Treatment

Reference Genes

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
CsTBP	TATA-box binding protein gene	Leaf development and metabolism Hormonal stimuli	AT5G09810 (Arabidopsis homolog gene)	F:GGCGGATCAAGTGTTGGAAGGGAG R:ACGCTTGGGATTGTATTCGGCATTA	166	85	SYBR
CsTIP41	Tap42-interacting protein of 41 kDa gene	Leaf development and metabolism	AT4G34270 (Arabidopsis homolog gene)	F:TGGAGTTGGAAGTGGACGAGACCGA R:CTCTGGAAAGTGGGATGTTTGAAGC	176	87	SYBR

Moleculer Type

• mRNA

Evaluation Methods

• geNorm method && Related Reference
• NormFinder method && Related Reference
• BestKeeper method && Related Reference

Contact

• Name: Jing Zhuang
• Email: zhuangjing@njau.edu.cn
• Institution: Tea Science Research Institute, College of Horticulture, Nanjing Agricultural University, Nanjing, 210095, China