Difference between revisions of "Canis lupus familiaris"

From ICG
Jump to navigation Jump to search
Line 43: Line 43:
 
|}
 
|}
  
===Moleculer Type===
+
===Molecular Type===
 
* mRNA
 
* mRNA
 +
 
===Evaluation Methods===
 
===Evaluation Methods===
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']

Revision as of 14:56, 22 June 2017

Description

Canis lupus familiaris-1.jpg
  • A decade of research on domestic dogs' responsiveness to human actions has led some to believe that all members of the species Canis familiaris possess a human-like social cognition not shared by their nondomesticated relatives.
  • Pet domestic dogs, Canis familiaris, are highly responsive to human actions and attentional states (reviewed in Udell & Wynne 2008). In many cases, different forms of human gestures appear to act as salient stimuli, resulting in above-chance performance on a variety of human-guided tasks。
  • This behaviour has often been interpreted as evidence for a human-like social cognition in domesticated canids, including a comprehension of referential meaning and cooperative intent[1] [2].

Different Disease Groups & Tissues

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPL13A[1] Ribosomal protein L13a
  • Universal reference genes
AJ388525
  • F:GCCGGAAGGTTGTAGTCGT
  • R:GGAGGAAGGCCAGGTAATTC
87 85 SYBR
RPL32[1] Ribosomal protein L32
  • Universal reference genes
XM_848016.1
  • F:TGGTTACAGGAGCAACAAGAAA
  • R:GCACATCAGCAGCACTTCA
100 87 SYBR

Molecular Type

  • mRNA

Evaluation Methods

Contact

  • Name: Iain R. Peters
  • Email: I.R.Peters@Bristol.ac.uk
  • Institution: School of Clinical Veterinary Science, University of Bristol, Langford House, Langford, Bristol BS40 5DU, UK

Citation Statistics

Cited by 126 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 Peters I R, Peeters D, Helps C R, et al. Development and application of multiple internal reference (housekeeper) gene assays for accurate normalisation of canine gene expression studies[J]. Veterinary immunology and immunopathology, 2007, 117(1): 55-66.
  2. Udell M A R, Dorey N R, Wynne C D L. The performance of stray dogs (Canis familiaris) living in a shelter on human-guided object-choice tasks[J]. Animal Behaviour, 2010, 79(3): 717-725.