Canis lupus familiaris

From ICG
Revision as of 08:48, 16 June 2017 by Xysj2012 (talk | contribs) (Created page with "=='''Description'''== ===Reference Genes=== {|class="wikitable sortable" style="font-size:10pt; width:100%" |- ! Gene Symbol ! Gene Name ! style="width=25% font-size:9pt...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search

Description

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
RPL13A[1] Ribosomal protein L13a

Universal reference genes

AJ388525
  • F:GCCGGAAGGTTGTAGTCGT
  • R:GGAGGAAGGCCAGGTAATTC
87 85 SYBR
RPL32[1] Ribosomal protein L32

Universal reference genes

XM_848016
  • F:TGGTTACAGGAGCAACAAGAAA
  • R:GCACATCAGCAGCACTTCA
100 87 SYBR

Moleculer Type

  • mRNA

Evaluation Methods

Contact

  • Name: Iain R. Peters
  • Email: I.R.Peters@Bristol.ac.uk
  • Institution: School of Clinical Veterinary Science, University of Bristol, Langford House, Langford, Bristol BS40 5DU, UK

References

  1. 1.0 1.1 Peters I R, Peeters D, Helps C R, et al. Development and application of multiple internal reference (housekeeper) gene assays for accurate normalisation of canine gene expression studies[J]. Veterinary immunology and immunopathology, 2007, 117(1): 55-66.