Canis lupus familiaris

From ICG
Jump to navigation Jump to search

Description

Canis lupus familiaris.png
  • Canis lupus familiaris, as a member of genus Canis (canines) that forms part of the wolf-like canids, is the most widely abundant carnivore. Pet domestic dogs are highly responsive to human actions and attentional states[1][2].
  • Common Name: Domestic dog
  • NCBI Taxonomy

Different Disease Groups & Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPL13A[1] Ribosomal protein L13a
  • Bone marrow, colon, duodenum
  • Heart, kidney, liver, lung
  • Lymph node, skeletal muscle
  • Pancreas, spleen, stomach
AJ388525
  • F:GCCGGAAGGTTGTAGTCGT
  • R:GGAGGAAGGCCAGGTAATTC
87 85 SYBR
RPL32[1] Ribosomal protein L32
  • Bone marrow, colon, duodenum
  • Heart, kidney, liver, lung
  • Lymph node, skeletal muscle
  • Pancreas, spleen, stomach
XM_848016.1
  • F:TGGTTACAGGAGCAACAAGAAA
  • R:GCACATCAGCAGCACTTCA
100 87 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Iain R. Peters
  • Email: I.R.Peters@Bristol.ac.uk
  • Institution: School of Clinical Veterinary Science, University of Bristol, Langford House, Langford, Bristol BS40 5DU, UK

Citation Statistics

Cited by 126 (Based on Google Scholar [2017-08-10])

Different Developmental Stages & Tissues

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPS5[3] Ribosomal protein S5
  • Whole brain
  • Whole body tissues
  • Forebrain and cerebrum
XM_533568
  • F:GGATGACCGAGTGGGAGA
  • R: TGCAATGTAGTCCTGCAAAGA
122 60 SYBR
RPL8[3] Ribosomal protein L8
  • Whole body tissues
XM_532360
  • F:AGGTCATTTCTTCCGCCAA
  • R: AGGATGCTCCACAGGATTCA
164 60 SYBR
RPS19[3] Ribosomal protein S19
  • Forebrain and cerebrum
  • Diencephalon
  • Hindbrain
XM_533657
  • F:GTGAACCAGCAGGAGTTCGT
  • R:GGAGGTACAGGTGCCGTG
175 60 SYBR
RPL32[3] 60S Ribosomal protein L32
  • Diencephalon
XM_844472
  • F:ATCGCTGGTTGGCTCAGTAG
  • R:AGAGAGAGGCAGAGACGGTG
112 60 SYBR
GAPDH[3] Glyceraldehyde-3-phospate dehydrogenase
  • Hindbrain
NM_001003142
  • F:CACAGTCAAGGCTGAGAACG
  • R:CACCAGCATCACCCCATTT
101 60 SYBR
MRPS7[3] Mitochondrial ribosomal protein S7
  • Metencephalon
XM_846915
  • F: GATCCCTCATGATGCAGACTC
  • R: GGCACAGGGACCTGATAAAA
196 60 SYBR
RPL13A[3] Ribosomal protein L13A
  • Metencephalon
AJ388525
  • F:AGGTTGTAGTCGTGCGCTGT
  • R: CATGCCTCTAACTGTCCGC
167 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Kyu-Tae Chang
  • Email: changkt@kribb.re.kr
  • Institution: S.-U. Kim ? K.-T. Chang (&) National Primate Research Center, Korea Research Institute of Bioscience and Biotechnology, Ochang, Chungbuk 363-883, Republic of Korea

Citation Statistics

Cited by 13 (Based on Google Scholar [2017-08-10])

References

  1. 1.0 1.1 1.2 Peters I R, Peeters D, Helps C R, et al. Development and application of multiple internal reference (housekeeper) gene assays for accurate normalisation of canine gene expression studies[J]. Veterinary immunology and immunopathology, 2007, 117(1): 55-66.
  2. Udell M A R, Dorey N R, Wynne C D L. The performance of stray dogs (Canis familiaris) living in a shelter on human-guided object-choice tasks[J]. Animal Behaviour, 2010, 79(3): 717-725.
  3. 3.0 3.1 3.2 3.3 3.4 3.5 3.6 Park, Sang-Je, et al. "Selection of internal reference genes for normalization of quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis in the canine brain and other organs." Molecular biotechnology 54.1 (2013): 47-57.

Categories