Difference between revisions of "Capsicum annuum"

From ICG
Jump to navigation Jump to search
Line 66: Line 66:
 
*'''Name''': Yuejian Yang  
 
*'''Name''': Yuejian Yang  
 
*'''Email''': hzyyj@yahoo.com.cn
 
*'''Email''': hzyyj@yahoo.com.cn
*'''Institute''': Institute of Vegetables, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, People’s Republic of China
+
*'''Institution''': Institute of Vegetables, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, People’s Republic of China
 +
 
 
===Citation Statistics===
 
===Citation Statistics===
 
Cited by '''72''' (Based on Google Scholar [2017-06-16])
 
Cited by '''72''' (Based on Google Scholar [2017-06-16])

Revision as of 15:07, 22 June 2017

Description

Capsicum annuum-1.jpg
  • Pepper (Capsicum annuum L.) belongs to the Solanaceae family,which is one of the largest families in the plant kingdom, and includes more than 3000 species. Some members of the Solanaceae family have been widely cultivated over the years for human nutrition and health, such as pepper, tomato, potato, and eggplant. Capsicum species are consumed worldwide and are valued because of their unique color, pungency, and aroma.
  • Dry hot pepper (Capsicum annum L.) is one of the most important spices used worldwide as a natural flavoring and coloring agent owing to its unique spicy and pungent taste and color. In addition, peppers are a rich source of nutrients and diverse bioactive compounds with potential health-promoting properties, such as capsaicinoids and antioxidant compounds. However, pepper is generally contaminated by molds, yeast and bacteria during the cultivation, drying, packaging, and storage processes[1] [2].

Different Tissues & Abiotic Stress & Hormonal Treatment

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
b-TUB[1] Beta tubulin
  • In sample pools with abiotic stress and hormonal treatments
EF495259
  • F:GAGGGTGAGTGAGCAGTTC
  • R: CTTCATCGTCATCTGCTGTC
167 55 SYBR
UBI-3[1] Ubiquitin-conjugating protein
  • In sample pools with abiotic stress and hormonal treatments;
  • In different tissues
AY486137
  • F:TGTCCATCTGCTCTCTGTTG
  • R: CACCCCAAGCACAATAAGAC
204 55 SYBR
GAPDH [1] Glyceraldehyde-3-phosphate dehydrogenase
  • In different tissues
AJ246013
  • F:ATGATGATGTGAAAGCAGCG
  • R: TTTCAACTGGTGGCTGCTAC
276 55 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Yuejian Yang
  • Email: hzyyj@yahoo.com.cn
  • Institution: Institute of Vegetables, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, People’s Republic of China

Citation Statistics

Cited by 72 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 Wan H, Yuan W, Ruan M, et al. Identification of reference genes for reverse transcription quantitative real-time PCR normalization in pepper (Capsicum annuum L.)[J]. Biochemical and biophysical research communications, 2011, 416(1): 24-30.
  2. Iqbal Q1, Amjad M2, Asi MR3, Nawaz A4, Khan SM5, Ariño A6, Ahmad T7. Irradiation Maintains Functional Components of Dry Hot Peppers (Capsicum annuum L.) under Ambient Storage. Foods. 2016 Sep 12;5(3). pii: E63. doi: 10.3390/foods5030063. PMID: 28231158 PMCID: PMC5302406 DOI: 10.3390/foods5030063.