Capsicum annuum

Description

Capsicum annuum L. belongs to the Solanaceae family, which is one of the largest families in the plant kingdom, and includes more than 3000 species. It is one of the most important spices used worldwide as a natural flavoring and coloring agent owing to its unique spicy and pungent taste and color. In addition, peppers are a rich source of nutrients and diverse bioactive compounds with potential health-promoting properties, such as capsaicinoids and antioxidant compounds^[1]^[2].
Common Name: Hot Pepper
NCBI Taxonomy

Gene Symbol	Gene Name	Application Scope	Accession Number	Primers (5'-3') [Forward/Reverse]	Size [bp]	Tm [℃]	Detection
b-TUB^[1]	Beta tubulin	In sample pools with abiotic stress and hormonal treatments	EF495259	F:GAGGGTGAGTGAGCAGTTC R: CTTCATCGTCATCTGCTGTC	167	55	SYBR
UBI-3^[1]	Ubiquitin-conjugating protein	In sample pools with abiotic stress and hormonal treatments; In different tissues	AY486137	F:TGTCCATCTGCTCTCTGTTG R: CACCCCAAGCACAATAAGAC	204	55	SYBR
GAPDH ^[1]	Glyceraldehyde-3-phosphate dehydrogenase	In different tissues	AJ246013	F:ATGATGATGTGAAAGCAGCG R: TTTCAACTGGTGGCTGCTAC	276	55	SYBR

Name: Yuejian Yang
Email: hzyyj@yahoo.com.cn
Institution: Institute of Vegetables, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, People’s Republic of China

Cited by 75 (Based on Google Scholar [2017-09-01])

↑ ^1.0 ^1.1 ^1.2 ^1.3 Wan H, Yuan W, Ruan M, et al. Identification of reference genes for reverse transcription quantitative real-time PCR normalization in pepper (Capsicum annuum L.)[J]. Biochemical and biophysical research communications, 2011, 416(1): 24-30.
↑ Iqbal Q1, Amjad M2, Asi MR3, Nawaz A4, Khan SM5, Ariño A6, Ahmad T7. Irradiation Maintains Functional Components of Dry Hot Peppers (Capsicum annuum L.) under Ambient Storage. Foods. 2016 Sep 12;5(3). pii: E63. doi: 10.3390/foods5030063. PMID: 28231158 PMCID: PMC5302406 DOI: 10.3390/foods5030063.