Difference between revisions of "Caragana korshinskii"

From ICG
Jump to navigation Jump to search
 
(10 intermediate revisions by 5 users not shown)
Line 1: Line 1:
  
 
==Description==
 
==Description==
[[File:REFqPCR2014021-1.jpg|right|327px|]]
+
[[File:Caragana korshinskii.png|right|200px|link=Caragana korshinskii]]
* Caragana intermedia, a native desert shrub with strong drought-resistance, sand-fixing capacity and high forage value that is widespread in the desert land of west and northwest China, has not been investigated regarding the identification of reference genes suitable for the normalization of qPCR data. In this study, 10 candidate reference genes were analyzed in C. intermedia subjected to different abiotic (osmotic, salt, cold and heat) stresses, in two distinct plant organs (roots and leaves).
+
* '''''Caragana korshinskii''''', a leguminous shrub species, is a native desert shrub with strong drought-resistance, sand-fixing capacity and high forage value that is widespread in the desert land of west and northwest China, is commonly found in arid and semi-arid lands in northwestern China. C. korshinskii, Hedysarum scoparium Fisch., and Artemisia ordosica Kracsh. were the main species initially employed for vegetation restoration in desert areas in China<ref name="ref1"/>.
* Results showed that the roots of C. korshinskii were distributed vertically in the uppermost portion of the soil profile, especially the coarse roots, which were concentrated in the upper 0.4 m.  The horizontal distribution of the root length and weight of C. korshinskii coarse roots was concentrated within 0.6 and 0.4 m of the trunk, respectively.
+
* <font color=blue>'''Common Name:'''</font> '''Peashrub '''
* Caragana korshinskii Kom, a leguminous shrub species, is commonly found in arid and semi-arid lands in northwestern China (Fang et al. 2006). C. korshinskii, Hedysarum scoparium Fisch., and Artemisia ordosica Kracsh. were the main species initially employed for vegetation restoration in desert areas in China. <ref name="ref1"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=220689 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Abiotic Stress'''''==
 
=='''''Abiotic Stress'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 20: Line 20:
 
|-
 
|-
 
|align="center"| GAPDH<ref name="ref1"/>
 
|align="center"| GAPDH<ref name="ref1"/>
|align="center"| glyceraldehyde 3-phosphate dehydrogenase
+
|align="center"| Glyceraldehyde 3-phosphate dehydrogenase
 
|
 
|
* Universial reference gene
+
* Drought, heat, cold, salt
 +
* ABA and high pH treatment
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KC679843 '''KC679843''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KC679843 '''KC679843''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 32: Line 33:
 
|-
 
|-
 
|align="center"| EF1a<ref name="ref1"/>
 
|align="center"| EF1a<ref name="ref1"/>
|align="center"| elongation factor 1-alpha-like
+
|align="center"| Elongation factor 1-alpha-like
 
|
 
|
* Universial reference gene
+
* Drought, heat, cold, salt
 +
* ABA and high pH treatment
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KC679842 '''KC679842''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KC679842 '''KC679842''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 46: Line 48:
 
|align="center"| F-box protein SKIP5-1-like
 
|align="center"| F-box protein SKIP5-1-like
 
|
 
|
* Universial reference gene
+
* Drought, heat, cold, salt
 +
* ABA and high pH treatment
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KC679845 '''KC679845''']  
 
|align="center"| [https://www.ncbi.nlm.nih.gov/nuccore/KC679845 '''KC679845''']  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
Line 56: Line 59:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 68: Line 72:
 
*'''Institution''': College of Life Sciences, Inner Mongolia Agricultural University, Hohhot 010018, People's Republic of China
 
*'''Institution''': College of Life Sciences, Inner Mongolia Agricultural University, Hohhot 010018, People's Republic of China
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''19''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=3237206524260810172&as_sdt=2005&sciodt=0,5&hl=en '''23'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 76: Line 80:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
 
[[Category:Plants]][[Category:mRNA]]
 
[[Category:Plants]][[Category:mRNA]]
 
[[Category:SYBR]]
 
[[Category:SYBR]]
 
[[Category:EF1α]] [[Category:GAPDH]] [[Category:SKIP]]
 
[[Category:EF1α]] [[Category:GAPDH]] [[Category:SKIP]]
 
[[Category:Cold Treatment]]  [[Category:Abiotic Stress]]  [[Category:Heat Treatment]]  [[Category:Salinity Treatment]]
 
[[Category:Cold Treatment]]  [[Category:Abiotic Stress]]  [[Category:Heat Treatment]]  [[Category:Salinity Treatment]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]

Latest revision as of 08:58, 1 September 2017

Description

Caragana korshinskii.png
  • Caragana korshinskii, a leguminous shrub species, is a native desert shrub with strong drought-resistance, sand-fixing capacity and high forage value that is widespread in the desert land of west and northwest China, is commonly found in arid and semi-arid lands in northwestern China. C. korshinskii, Hedysarum scoparium Fisch., and Artemisia ordosica Kracsh. were the main species initially employed for vegetation restoration in desert areas in China[1].
  • Common Name: Peashrub
  • NCBI Taxonomy

Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Drought, heat, cold, salt
  • ABA and high pH treatment
KC679843
  • F:GCATTCCGTGTACCTACTCCCA
  • R:CAACATCCTCGTCTGTGTATCCA
151 60 SYBR
EF1a[1] Elongation factor 1-alpha-like
  • Drought, heat, cold, salt
  • ABA and high pH treatment
KC679842
  • F:CAAAAAGTCCCCTCGTTGTCTC
  • R:AGCAATCGTTCTTCCTAATGATCTAA
142 60 SYBR
SKIP5-1[1] F-box protein SKIP5-1-like
  • Drought, heat, cold, salt
  • ABA and high pH treatment
KC679845
  • F:GCTTCCTTCCCCCTATTCCAG
  • R:AAAACACCAGGTTCAGATAAGTCTTTG
133 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Guojing Li
  • Email: liguojing@imau.edu.cn
  • Institution: College of Life Sciences, Inner Mongolia Agricultural University, Hohhot 010018, People's Republic of China

Citation Statistics

Cited by 23 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 Yang Q, Yin JJ, Li G, et al. (2014) Reference gene selection for qRT-PCR in Caragana korshinskii Kom. under different stress conditions. Molecular Biology Reports 41, 2325-2334.

Categories