Caragana korshinskii

From ICG
Jump to navigation Jump to search

Description

REFqPCR2014021-1.jpg
  • Caragana intermedia, a native desert shrub with strong drought-resistance, sand-fixing capacity and high forage value that is widespread in the desert land of west and northwest China, has not been investigated regarding the identification of reference genes suitable for the normalization of qPCR data. In this study, 10 candidate reference genes were analyzed in C. intermedia subjected to different abiotic (osmotic, salt, cold and heat) stresses, in two distinct plant organs (roots and leaves).
  • Results showed that the roots of C. korshinskii were distributed vertically in the uppermost portion of the soil profile, especially the coarse roots, which were concentrated in the upper 0.4 m. The horizontal distribution of the root length and weight of C. korshinskii coarse roots was concentrated within 0.6 and 0.4 m of the trunk, respectively.
  • Caragana korshinskii Kom, a leguminous shrub species, is commonly found in arid and semi-arid lands in northwestern China (Fang et al. 2006). C. korshinskii, Hedysarum scoparium Fisch., and Artemisia ordosica Kracsh. were the main species initially employed for vegetation restoration in desert areas in China. [1].

Abiotic Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Universial reference gene
KC679843
  • F:GCATTCCGTGTACCTACTCCCA
  • R:CAACATCCTCGTCTGTGTATCCA
151 60 SYBR
EF1a[1] Elongation factor 1-alpha-like
  • Universial reference gene
KC679842
  • F:CAAAAAGTCCCCTCGTTGTCTC
  • R:AGCAATCGTTCTTCCTAATGATCTAA
142 60 SYBR
SKIP5-1[1] F-box protein SKIP5-1-like
  • Universial reference gene
KC679845
  • F:GCTTCCTTCCCCCTATTCCAG
  • R:AAAACACCAGGTTCAGATAAGTCTTTG
133 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Guojing Li
  • Email: liguojing@imau.edu.cn
  • Institution: College of Life Sciences, Inner Mongolia Agricultural University, Hohhot 010018, People's Republic of China

Citation Statistics

Cited by 19 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 1.2 1.3 Yang Q, Yin JJ, Li G, et al. (2014) Reference gene selection for qRT-PCR in Caragana korshinskii Kom. under different stress conditions. Molecular Biology Reports 41, 2325-2334.