Difference between revisions of "Casuarina glauca"

From ICG
Jump to navigation Jump to search
 
(9 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:REFqPCR2015006-1.jpg|right|327px|]]
+
[[File:Casuarina glauca.png|right|200px|link=Casuarina glauca]]
* Casuarina glauca is a model actino rhizal plant species that establishes N 2-fixing symbiosis with Frankia bacteria. This plant is highly resilient to extreme environments, beingcommonlyfound insalinezones. Actinorhizal plants are a group of perennial dicotyledonous angiosperms distributed over three orders (Fagales, Cucurbitales and Rosales), eight families and 25 genera.
+
* '''''Casuarina glauca''''' is a model actinorhizal plant species that are able to establish root-nodule symbiosis with N 2 -fixing Frankia bacteria and are often pioneer on nitrogen-poor sites. This plant is of great economic and ecological relevance because it is highly resilient to extreme environments (drought and high salinity). C.glauca trees are frequently used to colonize, enrich and recover poor sites and reshape the global landscape. It is also considered as the model of actinorhizal plants due to the availability of a genetic transformation system and the extensive research basis of symbiosis with Frankia and mycorrhiza<ref name="ref1"/> <ref name="ref2"/>.
* Most actinorhizal plants are able to establish root-nodule symbiosis with N 2 -fixing Frankia bacteria and are often pioneer on nitrogen-poor sites. Besides that, this group of plants is of great economic and ecological relevance. Casuarina glauca Sieb. Ex Spreng. (fam. Casuarinaceae, order Fagales) is native to southeastern coastal regions of Australia, being widely disseminated in tropical and sub-tropical regions of America, Africa, Asia and New Zealand.
+
* <font color=blue>'''Common Name:'''</font> '''Swamp she-oak''','''Swamp oak''','''Grey oak''','''River oak'''
* It grows naturally in the saline soils of coastal zones and is able to thrive under adverse conditions, such as drought and high salinity. This capacity has been attributed to a set of plant-related physiological alterations.Thus,C.glaucatreesare frequently used to colonize, enrich and recover poor sites and have become increasingly important as climate changes threaten to reshape the global landscape over the next decades. Interestingly, for several reasons C. glauca is also considered the model of actinorhizal plants. First, it is suitable for basic research due to the availability of a genetic transformation system. Second, the biology of C. glauca symbiosis with Frankia and mycorrhiza has been extensively studied. <ref name="ref1"/> <ref name="ref2"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=3522 <font color=blue>'''NCBI Taxonomy'''</font>]
 +
 
 
=='''''Different Tissues & Abiotic Stress'''''==
 
=='''''Different Tissues & Abiotic Stress'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 24: Line 25:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:TCTTGAGGGTGAAATCGTTCG
 
* F:TCTTGAGGGTGAAATCGTTCG
* R:TCTTGAGGGTGAAATCGTTCG
+
* R:TGATGCATAGCGCCTGTATAC
 
|align="center"|  NA  
 
|align="center"|  NA  
 
|align="center"| 60
 
|align="center"| 60
Line 30: Line 31:
 
|-
 
|-
 
|align="center"| PP2A<ref name="ref1"/>
 
|align="center"| PP2A<ref name="ref1"/>
|align="center"| serine threonine protein phosphatase  
+
|align="center"| Serine threonine protein phosphatase  
 
|
 
|
 
* Branchlets  
 
* Branchlets  
Line 36: Line 37:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:AATAGGCCGGTAAGCTCGAA
 
* F:AATAGGCCGGTAAGCTCGAA
* R:AATAGGCCGGTAAGCTCGAA
+
* R:ACATCCCTGAATCCTGGCAA
 
|align="center"|  NA  
 
|align="center"|  NA  
 
|align="center"| 60
 
|align="center"| 60
Line 48: Line 49:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:GCTGGATCATCTCATGCAAA
 
* F:GCTGGATCATCTCATGCAAA
* R:GCTGGATCATCTCATGCAAA
+
* R:CAAAAGCCGCAATCTTCTTC
 
|align="center"|  NA  
 
|align="center"|  NA  
 
|align="center"| 60
 
|align="center"| 60
Line 60: Line 61:
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:CACTTGAAGGGAGGTGCAAAG
 
* F:CACTTGAAGGGAGGTGCAAAG
* R:CACTTGAAGGGAGGTGCAAAG
+
* R:GTGCAGCTAGCATTGGAGATG
 
|align="center"|  NA  
 
|align="center"|  NA  
 
|align="center"| 60
 
|align="center"| 60
 
|align="center"| Luminaris HiGreen
 
|align="center"| Luminaris HiGreen
 
|}
 
|}
===Moleculer Types===
+
 
 +
===Molecular Types===
 
*mRNA
 
*mRNA
 
===Evaluation Methods===  
 
===Evaluation Methods===  
Line 79: Line 81:
  
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''6''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=1525801008986737063&as_sdt=2005&sciodt=0,5&hl=en '''7'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 90: Line 92:
 
</ref>
 
</ref>
 
</references>
 
</references>
 
+
=='''Categories'''==
[[Category:Plants]]
+
[[Category:Plants]][[Category:mRNA]][[Category:Luminaris HiGreen]]
[[Category:mRNA]] 
 
[[Category:Luminaris HiGreen]]
 
 
[[Category:AP]] [[Category:GAPDH]] [[Category:PP2A]] [[Category:RPS]]
 
[[Category:AP]] [[Category:GAPDH]] [[Category:PP2A]] [[Category:RPS]]
 
[[Category:Salinity Treatment]]  [[Category:Different Tissues]]  [[Category:Abiotic Stress]]
 
[[Category:Salinity Treatment]]  [[Category:Different Tissues]]  [[Category:Abiotic Stress]]
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
[[Category:Delta Ct]]
 +
[[Category:RefFinder]]

Latest revision as of 09:02, 1 September 2017

Description

Casuarina glauca.png
  • Casuarina glauca is a model actinorhizal plant species that are able to establish root-nodule symbiosis with N 2 -fixing Frankia bacteria and are often pioneer on nitrogen-poor sites. This plant is of great economic and ecological relevance because it is highly resilient to extreme environments (drought and high salinity). C.glauca trees are frequently used to colonize, enrich and recover poor sites and reshape the global landscape. It is also considered as the model of actinorhizal plants due to the availability of a genetic transformation system and the extensive research basis of symbiosis with Frankia and mycorrhiza[1] [2].
  • Common Name: Swamp she-oak,Swamp oak,Grey oak,River oak
  • NCBI Taxonomy

Different Tissues & Abiotic Stress

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
Ap47[1] Clathrin adaptor complexes subunit
  • Branchlets & nodules
FQ318589.1
  • F:TCTTGAGGGTGAAATCGTTCG
  • R:TGATGCATAGCGCCTGTATAC
NA 60 Luminaris HiGreen
PP2A[1] Serine threonine protein phosphatase
  • Branchlets
FQ365636
  • F:AATAGGCCGGTAAGCTCGAA
  • R:ACATCCCTGAATCCTGGCAA
NA 60 Luminaris HiGreen
S23[1] 40S ribosomal protein
  • Roots & nodules
FQ318261
  • F:GCTGGATCATCTCATGCAAA
  • R:CAAAAGCCGCAATCTTCTTC
NA 60 Luminaris HiGreen
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Roots
FQ312704.1
  • F:CACTTGAAGGGAGGTGCAAAG
  • R:GTGCAGCTAGCATTGGAGATG
NA 60 Luminaris HiGreen

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ana I. Ribeiro-Barros
  • Email: aribeiro@itqb.unl.pt
  • Institution: Grupo Interações Planta-Ambiente & Biodiversidade (PlantStress&Biodiversity), Instituto de Investigação Científica Tropical, Universidade de Lisboa, Av. República, Quinta do Marquês, 2784-505 Oeiras, Portugal

Citation Statistics

Cited by 7 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 da Costa M, Duro N, Batista-Santos P, Ramalho JC, Ribeiro-Barros AI (2015) Validation of candidate reference genes for qRT-PCR studies in symbiotic and non-symbiotic Casuarina glauca Sieb. ex Spreng. under salinity conditions. Symbiosis 66, 21-35.
  2. Pawlowski K, Demchenko KN (2012) The diversity of actinorhizal symbiosis. Protoplasma 249, 967-979.

Categories