Difference between revisions of "Casuarina glauca"

From ICG
Jump to navigation Jump to search
(Created page with "==Description== right|327px| * Casuarina glauca is a model actino rhizal plant species that establishes N 2-fixing symbiosis with Frankia bacteri...")
 
Line 77: Line 77:
 
*'''Email''': aribeiro@itqb.unl.pt
 
*'''Email''': aribeiro@itqb.unl.pt
 
*'''Institution''': Grupo Interações Planta-Ambiente & Biodiversidade (PlantStress&Biodiversity), Instituto de Investigação Científica Tropical, Universidade de Lisboa, Av. República, Quinta do Marquês, 2784-505 Oeiras, Portugal
 
*'''Institution''': Grupo Interações Planta-Ambiente & Biodiversidade (PlantStress&Biodiversity), Instituto de Investigação Científica Tropical, Universidade de Lisboa, Av. República, Quinta do Marquês, 2784-505 Oeiras, Portugal
 +
 +
==Citation Statistics==
 +
Cited by '''6''' (Based on Google Scholar [2017-06-01])
  
 
=='''References'''==
 
=='''References'''==
Line 87: Line 90:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
[[Category:Plants]]

Revision as of 10:10, 16 June 2017

Description

REFqPCR2015006-1.jpg
  • Casuarina glauca is a model actino rhizal plant species that establishes N 2-fixing symbiosis with Frankia bacteria. This plant is highly resilient to extreme environments, beingcommonlyfound insalinezones. Actinorhizal plants are a group of perennial dicotyledonous angiosperms distributed over three orders (Fagales, Cucurbitales and Rosales), eight families and 25 genera.
  • Most actinorhizal plants are able to establish root-nodule symbiosis with N 2 -fixing Frankia bacteria and are often pioneer on nitrogen-poor sites. Besides that, this group of plants is of great economic and ecological relevance. Casuarina glauca Sieb. Ex Spreng. (fam. Casuarinaceae, order Fagales) is native to southeastern coastal regions of Australia, being widely disseminated in tropical and sub-tropical regions of America, Africa, Asia and New Zealand.
  • It grows naturally in the saline soils of coastal zones and is able to thrive under adverse conditions, such as drought and high salinity. This capacity has been attributed to a set of plant-related physiological alterations.Thus,C.glaucatreesare frequently used to colonize, enrich and recover poor sites and have become increasingly important as climate changes threaten to reshape the global landscape over the next decades. Interestingly, for several reasons C. glauca is also considered the model of actinorhizal plants. First, it is suitable for basic research due to the availability of a genetic transformation system. Second, the biology of C. glauca symbiosis with Frankia and mycorrhiza has been extensively studied. [1] [2].

Different Tissues & Salinity Conditions

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
Ap47[1] Clathrin adaptor complexes subunit
  • Branchlets & nodules
FQ318589.1
  • F:TCTTGAGGGTGAAATCGTTCG
  • R:TCTTGAGGGTGAAATCGTTCG
NA 60 Luminaris HiGreen
PP2A[1] serine threonine protein phosphatase
  • Branchlets
FQ365636
  • F:AATAGGCCGGTAAGCTCGAA
  • R:AATAGGCCGGTAAGCTCGAA
NA 60 Luminaris HiGreen
S23[1] 40S ribosomal protein
  • Roots & Nodules
FQ318261
  • F:GCTGGATCATCTCATGCAAA
  • R:GCTGGATCATCTCATGCAAA
NA 60 Luminaris HiGreen
GAPDH[1] Glyceraldehyde 3-phosphate dehydrogenase
  • Roots
FQ312704.1
  • F:CACTTGAAGGGAGGTGCAAAG
  • R:CACTTGAAGGGAGGTGCAAAG
NA 60 Luminaris HiGreen

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Ana I. Ribeiro-Barros
  • Email: aribeiro@itqb.unl.pt
  • Institution: Grupo Interações Planta-Ambiente & Biodiversidade (PlantStress&Biodiversity), Instituto de Investigação Científica Tropical, Universidade de Lisboa, Av. República, Quinta do Marquês, 2784-505 Oeiras, Portugal

Citation Statistics

Cited by 6 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Pawlowski K, Demchenko KN (2012) The diversity of actinorhizal symbiosis. Protoplasma 249, 967-979.
  2. da Costa M, Duro N, Batista-Santos P, Ramalho JC, Ribeiro-Barros AI (2015) Validation of candidate reference genes for qRT-PCR studies in symbiotic and non-symbiotic Casuarina glauca Sieb. ex Spreng. under salinity conditions. Symbiosis 66, 21-35.