Difference between revisions of "Channa striatus"

From ICG
Jump to navigation Jump to search
Line 81: Line 81:
  
 
[[Category:Animals]]
 
[[Category:Animals]]
 +
[[Category:mRNA]] 
 +
[[Category:SYBR]]

Revision as of 07:22, 19 June 2017

Description

REFqPCR2017009-1.jpg
  • Channa striata (snakehead murrel) is a species of snakehead fish. It is also known as the common snakehead, chevron snakehead, and striped snakehead. It is native to South and Southeast Asia, and has been introduced to some Pacific Islands (reports from Madagascar and Hawaii are misidentifications of C. maculata).
  • Channa striatus, the fresh water snakehead fish of Channidae family that normally resides in a temperature of 25–27 C have long been regarded as valuable fish in far East.
  • Striped snakehead, Channa striatus, is a freshwater, obligatory air-breathing carnivorous fish that were once considered a pest or as a means to control unwanted fry and fingerlings production from tilapia or carp in aquaculture ponds.[1] [2].

High-temperature Stress

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
tub[1] Channa striata alpha-tubulin
  • Liver and gill tissues under both short- and long-term thermal stress
KC710731
  • F:CCTGCTGGGAACTGTATTGT
  • R:CCTGCTGGGAACTGTATTGT
89 54 SYBR
βactin[1] Channa striata beta-actin
  • Liver, gill and lmuscle tissues under both short- and long-term thermal stress
KC967219
  • F:GCCTTCCTTCCTTGGTATGG
  • R:GCCTTCCTTCCTTGGTATGG
89 59 SYBR
gapdh[1] glyceraldehyde-3-phosphate dehydrogenase, partial cds
  • Lmuscle tissues under both short- and long-term thermal stress
KF044311
  • F:ATCAAGGAAGCGGTGAAGAAGG
  • R:ATCAAGGAAGCGGTGAAGAAGG
99 60 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Sasmita Mohanty
  • Email: smohanty@kiitbiotech.ac.in
  • Institution: KIIT School of Biotechnology, KIIT University, Bhubaneswar, Odisha 751024, India

Citation Statistics

Cited by 5 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 1.3 Purohit GK, Mahanty A, Mohanty BP, Mohanty S (2016) Evaluation of housekeeping genes as references for quantitative real-time PCR analysis of gene expression in the murrel Channa striatus under high-temperature stress. Fish Physiol Biochem 42, 125-135.
  2. Muntaziana AMP, Amin SMN, Kamarudin MS, Rahim A, Romano N (2017) Feeding frequency influences the survival, growth and body lipid content of striped snakehead, Channa striatus (Bloch) fry. Aquaculture Research 48, 2602-2606.