Difference between revisions of "Chlamydomonas"

From ICG
Jump to navigation Jump to search
Line 30: Line 30:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
* mRNA
 
* mRNA
  

Revision as of 15:31, 22 June 2017

Description

Chlamydomonas-1.png
  • Chloromonas (Cr.), is used as a model organism for molecular biology, is a genus of green algae consisting of unicellular flagellates, found in stagnant water and on damp soil, in freshwater, seawater, and even in snow. It is a unicellular biflagellate in the green algal order Volvocales, is traditionally distinguished from its close relative, Chlamydomonas (Cd.), by lacking pyrenoids in its chloroplasts, and several species in these genera have been reassessed recently with respect to their taxonomy. Chloromonas has more species identified from cold habitats than does Chlamydomonas, and many of these taxa reside in snow[1] [2].

Freezing Acclimation

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
RPL19[1] 60S ribosomal protein L19
  • Freezing stress
NA
  • F:CCAATGAGGTCAACGAGATTTCC
  • R:ATCACAAATCCGTCCTTCACCAG
150 60 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Chenlin Liu
  • Email: ch.lliu@163.com
  • Institute: The First Institute of Oceanography, Marine Ecological Center, State Oceanic Administration, Qingdao 266061, China

Citation Statistics

Cited by 23 (Based on Google Scholar [2017-06-16])

References

  1. 1.0 1.1 Liu C, Wu G, Huang X, et al. Validation of housekeeping genes for gene expression studies in an ice alga Chlamydomonas during freezing acclimation[J]. Extremophiles, 2012, 16(3): 419-425.
  2. Barsalobres-Cavallari C, Severino F, Maluf M, Maia I. Identification of suitable internal control genes for expression studies in Coffea arabica under different experimental conditions. BMC Mol Biol 10(1):1.