Difference between revisions of "Chortoicetes terminifera"

From ICG
Jump to navigation Jump to search
 
(9 intermediate revisions by 4 users not shown)
Line 1: Line 1:
 
=='''Description'''==
 
=='''Description'''==
[[File:Chortoicetes terminifera.jpg|right|237px]]
+
[[File:Chortoicetes terminifera.png|right|200px|link=Chortoicetes terminifera]]
*The Australian plague locust (Chortoicetes terminifera) is a native Australian insect in the family Acrididae, and a significant agricultural pest.
+
*'''''Chortoicetes terminifera''''' is a native Australian insect in the family Acrididae, and a significant agricultural pest. Adult Australian plague locusts range in size from 20 to 45 mm in length, and the colour varies from brown to green. In profile, the head is higher than the thorax, and the thorax has an X-shaped mark. The legs have a reddish shank and the wings are clear other than for a dark spot on the end. In eastern Australia, most outbreaks of the Australian plague locust develop when there is a sequence of regular rains in the interior that allow population increase<ref name="ref1"/><ref name="ref2"/>.
*Adult Australian plague locusts range in size from 20 to 45 mm in length, and the colour varies from brown to green. In profile, the head is higher than the thorax, and the thorax has an X-shaped mark. The legs have a reddish shank and the wings are clear other than for a dark spot on the end.
+
* <font color=blue>'''Common Name:'''</font> '''Locusts'''
*In eastern Australia, most outbreaks of the Australian plague locust, Chortoicetes terminifera(Walker) (Orthoptera:Acrididae), develop when there is a sequence of regular rains in the interior that allow population increase (Wright,1987; Hunter, 1996)<ref name="ref1"/><ref name="ref2"/>.
+
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=519494 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''Density-Dependent Behavioural plasticity'''==
 
=='''Density-Dependent Behavioural plasticity'''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 42: Line 42:
 
|align="center"| SYBR
 
|align="center"| SYBR
 
|}
 
|}
===Molecular Type===
+
 
 +
===Molecular Types===
 
* mRNA
 
* mRNA
  
Line 53: Line 54:
 
*'''Institution''': School of Biological Sciences, University of Sydney, Sydney, NSW 2006, Australia
 
*'''Institution''': School of Biological Sciences, University of Sydney, Sydney, NSW 2006, Australia
 
===Citation Statistics===
 
===Citation Statistics===
Cited by '''39''' (Based on Google Scholar [2017-06-16])
+
Cited by [https://scholar.google.com/scholar?cites=6771531858100707554&as_sdt=2005&sciodt=0,5&hl=en '''41'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
Line 68: Line 69:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
=='''Categories'''==
 
[[Category:Animals]]
 
[[Category:Animals]]
 
[[Category:mRNA]]
 
[[Category:mRNA]]
Line 74: Line 76:
 
[[Category:Arm]] [[Category:EF1α]]
 
[[Category:Arm]] [[Category:EF1α]]
 
[[Category:Specific Tissue]]  [[Category:Abiotic Stress]]
 
[[Category:Specific Tissue]]  [[Category:Abiotic Stress]]
 +
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]

Latest revision as of 06:56, 1 September 2017

Description

Chortoicetes terminifera.png
  • Chortoicetes terminifera is a native Australian insect in the family Acrididae, and a significant agricultural pest. Adult Australian plague locusts range in size from 20 to 45 mm in length, and the colour varies from brown to green. In profile, the head is higher than the thorax, and the thorax has an X-shaped mark. The legs have a reddish shank and the wings are clear other than for a dark spot on the end. In eastern Australia, most outbreaks of the Australian plague locust develop when there is a sequence of regular rains in the interior that allow population increase[1][2].
  • Common Name: Locusts
  • NCBI Taxonomy

Density-Dependent Behavioural plasticity

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
EF1a[1] Elongation factor 1 alpha
  • Different rearing density treatments in neural tissue
HQ388819
  • F:AGCCCAGGAGATGGGTAAAG
  • R:CTCTGTGGCCTGGAGCATC
155 81.4 SYBR
Arm[1] Armadillo
  • Different rearing density treatments in neural tissue
HQ388818
  • F:ACTTCTTATGAGAGCATTCCAGGAT
  • R:CCTTCAACAATTTCTTCCATGC
114 83.2 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Marie-Pierre Chapuis
  • Email: marie-pierre.chapuis@cirad.fr
  • Institution: School of Biological Sciences, University of Sydney, Sydney, NSW 2006, Australia

Citation Statistics

Cited by 41 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Chapuis M P, Tohidi-Esfahani D, Dodgson T, et al. Assessment and validation of a suite of reverse transcription-quantitative PCR reference genes for analyses of density-dependent behavioural plasticity in the Australian plague locust[J]. BMC molecular biology, 2011, 12(1): 7.
  2. Hunter DM, Milner RJ, Spurgin PA. Aerial treatment of the Australian plague locust, Chortoicetes terminifera (Orthoptera: Acrididae) with Metarhizium anisopliae (Deuteromycotina: Hyphomycetes). Bull Entomol Res. 2001 Apr;91(2):93-9. PubMed PMID: 11260723.

Categories