Difference between revisions of "Chrysanthemum lavandulifolium"

From ICG
Jump to navigation Jump to search
 
(17 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 
==Description==
 
==Description==
[[File:REFqPCR2016018-1.jpg|right|227px|]]
+
[[File:Chrysanthemum lavandulifolium.png|right|200px|link=Chrysanthemum lavandulifolium]]
* Chrysanthemum (Chrysanthemum × morifolium Ramat.), one of the 10 most well-known Chinese traditional flowers, is composed of the most abundant and various cultivars among the horticultural plants around the world. The petal types of chrysanthemums were classified into five groups containing flat, tubular, spoon, abnormal, and anemone. The diversity of the flower shape is determined by the numbers of the two types of florets and the variation of petal types.  
+
* ''''' Chrysanthemum lavandulifolium''''', one of the 10 most well-known Chinese traditional flowers, is composed of the most abundant and various cultivars among the horticultural plants around the world. The petal types of chrysanthemums were classified into five groups containing flat, tubular, spoon, abnormal, and anemone.  
 
+
* Herbs, perennial. Stems 30-150 cm, erect, corymbosely branched above middle or only in upper part, pilose, especially in upper part and on synflorescence branches. Basal and lower stem leaves withered by anthesis; middle stem leaves: petiole 0.5-1 cm; leaf blade ovate, broadly ovate, elliptic-ovate, narrowly elliptic, or ovate-lanceolate, 2-7 × 1.5-4.5 cm, surfaces concolorous or nearly so, 2-pinnatisect, 2-pinnatipartite, or inconspicuously 2-pinnatipartite; primary lateral segments 2 or 3(or 4) pairs; ultimate lobes elliptic. Upper stem leaves small, tripartite or entire<ref name="ref1"/> <ref name="ref2"/>.
* Herbs, perennial. Stems 30-150 cm, erect, corymbosely branched above middle or only in upper part, pilose, especially in upper part and on synflorescence branches. Basal and lower stem leaves withered by anthesis; middle stem leaves: petiole 0.5-1 cm; leaf blade ovate, broadly ovate, elliptic-ovate, narrowly elliptic, or ovate-lanceolate, 2-7 × 1.5-4.5 cm, surfaces concolorous or nearly so, 2-pinnatisect, 2-pinnatipartite, or inconspicuously 2-pinnatipartite; primary lateral segments 2 or 3(or 4) pairs; ultimate lobes elliptic. Upper stem leaves small, tripartite or entire<ref name="ref1"/> <ref name="ref2"/>.
+
* <font color=blue>'''Common Name:'''</font> '''Gan ju'''
 +
* [https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=146996 <font color=blue>'''NCBI Taxonomy'''</font>]
  
 
=='''''Flower Development'''''==
 
=='''''Flower Development'''''==
===Reference Genes===
+
===Internal Control Genes===
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
{|class="wikitable sortable" style="font-size:10pt; width:100%"
 
|-
 
|-
Line 13: Line 14:
 
! style="width=25% font-size:9pt "|Application Scope  
 
! style="width=25% font-size:9pt "|Application Scope  
 
! Accession Number  
 
! Accession Number  
! Primer
+
! Primers (5'-3')<br>[Forward/Reverse]
 
! Size [bp]  
 
! Size [bp]  
 
! Tm [℃]
 
! Tm [℃]
Line 21: Line 22:
 
|align="center"| SAND family protein
 
|align="center"| SAND family protein
 
|
 
|
* Universal reference gene
+
* Flower development
 +
* Leaves
 
|align="center"| NA  
 
|align="center"| NA  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:CGTTGCTCACTACGAGTTCAC
 
* F:CGTTGCTCACTACGAGTTCAC
* R:CGTTGCTCACTACGAGTTCAC
+
* R:GCAGATGGGTCAACAGGTAA
 
|align="center"|  178  
 
|align="center"|  178  
 
|align="center"| 62.1
 
|align="center"| 62.1
Line 33: Line 35:
 
|align="center"| Phosphoglycerate kinase
 
|align="center"| Phosphoglycerate kinase
 
|
 
|
* Universal reference gene
+
* Flower Development
 +
* Leaves
 
|align="center"| NA  
 
|align="center"| NA  
 
|nowrap style="font-size:9pt"|
 
|nowrap style="font-size:9pt"|
 
* F:ATACCTAATGGACGAAGAGA
 
* F:ATACCTAATGGACGAAGAGA
* R:ATACCTAATGGACGAAGAGA
+
* R:TTATTGTCGTCTTTACTACCA
 
|align="center"|  248  
 
|align="center"|  248  
 
|align="center"| 64.1
 
|align="center"| 64.1
Line 43: Line 46:
 
|}
 
|}
  
===Moleculer Types===
+
===Molecular Types===
 
*mRNA
 
*mRNA
 +
 
===Evaluation Methods===  
 
===Evaluation Methods===  
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
 
* [https://genorm.cmgg.be/ '''geNorm method''']  && [https://www.ncbi.nlm.nih.gov/pubmed/12184808 '''Related Reference''']
Line 56: Line 60:
 
*'''Institution''': College of Landscape Architecture, Beijing Forestry University, Beijing, China
 
*'''Institution''': College of Landscape Architecture, Beijing Forestry University, Beijing, China
  
==Citation Statistics==
+
===Citation Statistics===
Cited by '''0''' (Based on Google Scholar [2017-06-01])
+
Cited by [https://scholar.google.com/scholar?cites=15675911139437331860&as_sdt=2005&sciodt=0,5&hl=en '''11'''] (Based on Google Scholar [2017-09-01])
  
 
=='''References'''==
 
=='''References'''==
 
<references>
 
<references>
 
<ref name="ref1">
 
<ref name="ref1">
Hu P, Niu J, Yu M, Lin S-Y (2017) Facile Solvothermal Synthesis of Reduced Graphene Oxide-BiPO 4 Nanocomposite with Enhanced Photocatalytic Activity. Chinese Journal of Analytical Chemistry 45, 357-362.
+
Qi S, Yang L, Wen X, et al. (2016) Reference Gene Selection for RT-qPCR Analysis of Flower Development in Chrysanthemum morifolium and Chrysanthemum lavandulifolium. Front Plant Sci 7, 287.
 
</ref>
 
</ref>
 
<ref name="ref2">
 
<ref name="ref2">
Qi S, Yang L, Wen X, et al. (2016) Reference Gene Selection for RT-qPCR Analysis of Flower Development in Chrysanthemum morifolium and Chrysanthemum lavandulifolium. Front Plant Sci 7, 287.
+
Hu P, Niu J, Yu M, Lin S-Y (2017) Facile Solvothermal Synthesis of Reduced Graphene Oxide-BiPO 4 Nanocomposite with Enhanced Photocatalytic Activity. Chinese Journal of Analytical Chemistry 45, 357-362.
 
</ref>
 
</ref>
 
</references>
 
</references>
 
+
=='''Categories'''==
[[Category:Plants]]
+
[[Category:Plants]][[Category:mRNA]][[Category:SYBR]]
[[Category:mRNA]] 
+
[[Category:PGK]] [[Category:SAND]]
[[Category:SYBR]]
+
[[Category:Flower Development]]
 +
[[Category:geNorm]]
 +
[[Category:NormFinder]]
 +
[[Category:BestKeeper]]
 +
[[Category:RefFinder]]

Latest revision as of 09:03, 1 September 2017

Description

Chrysanthemum lavandulifolium.png
  • Chrysanthemum lavandulifolium, one of the 10 most well-known Chinese traditional flowers, is composed of the most abundant and various cultivars among the horticultural plants around the world. The petal types of chrysanthemums were classified into five groups containing flat, tubular, spoon, abnormal, and anemone.
  • Herbs, perennial. Stems 30-150 cm, erect, corymbosely branched above middle or only in upper part, pilose, especially in upper part and on synflorescence branches. Basal and lower stem leaves withered by anthesis; middle stem leaves: petiole 0.5-1 cm; leaf blade ovate, broadly ovate, elliptic-ovate, narrowly elliptic, or ovate-lanceolate, 2-7 × 1.5-4.5 cm, surfaces concolorous or nearly so, 2-pinnatisect, 2-pinnatipartite, or inconspicuously 2-pinnatipartite; primary lateral segments 2 or 3(or 4) pairs; ultimate lobes elliptic. Upper stem leaves small, tripartite or entire[1] [2].
  • Common Name: Gan ju
  • NCBI Taxonomy

Flower Development

Internal Control Genes

Gene Symbol Gene Name Application Scope Accession Number Primers (5'-3')
[Forward/Reverse]
Size [bp] Tm [℃] Detection
SAND[1] SAND family protein
  • Flower development
  • Leaves
NA
  • F:CGTTGCTCACTACGAGTTCAC
  • R:GCAGATGGGTCAACAGGTAA
178 62.1 SYBR
PGK[1] Phosphoglycerate kinase
  • Flower Development
  • Leaves
NA
  • F:ATACCTAATGGACGAAGAGA
  • R:TTATTGTCGTCTTTACTACCA
248 64.1 SYBR

Molecular Types

  • mRNA

Evaluation Methods

Contact

  • Name: Silan Dai
  • Email: silandai@sina.com
  • Institution: College of Landscape Architecture, Beijing Forestry University, Beijing, China

Citation Statistics

Cited by 11 (Based on Google Scholar [2017-09-01])

References

  1. 1.0 1.1 1.2 Qi S, Yang L, Wen X, et al. (2016) Reference Gene Selection for RT-qPCR Analysis of Flower Development in Chrysanthemum morifolium and Chrysanthemum lavandulifolium. Front Plant Sci 7, 287.
  2. Hu P, Niu J, Yu M, Lin S-Y (2017) Facile Solvothermal Synthesis of Reduced Graphene Oxide-BiPO 4 Nanocomposite with Enhanced Photocatalytic Activity. Chinese Journal of Analytical Chemistry 45, 357-362.

Categories