Chrysanthemum lavandulifolium

From ICG
Revision as of 10:01, 16 June 2017 by ICG Expert4 (talk | contribs)
Jump to navigation Jump to search

Description

REFqPCR2016018-1.jpg
  • Chrysanthemum (Chrysanthemum × morifolium Ramat.), one of the 10 most well-known Chinese traditional flowers, is composed of the most abundant and various cultivars among the horticultural plants around the world. The petal types of chrysanthemums were classified into five groups containing flat, tubular, spoon, abnormal, and anemone. The diversity of the flower shape is determined by the numbers of the two types of florets and the variation of petal types.
  • Herbs, perennial. Stems 30-150 cm, erect, corymbosely branched above middle or only in upper part, pilose, especially in upper part and on synflorescence branches. Basal and lower stem leaves withered by anthesis; middle stem leaves: petiole 0.5-1 cm; leaf blade ovate, broadly ovate, elliptic-ovate, narrowly elliptic, or ovate-lanceolate, 2-7 × 1.5-4.5 cm, surfaces concolorous or nearly so, 2-pinnatisect, 2-pinnatipartite, or inconspicuously 2-pinnatipartite; primary lateral segments 2 or 3(or 4) pairs; ultimate lobes elliptic. Upper stem leaves small, tripartite or entire. [1] [2].

Flower Development

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
SAND[1] SAND family protein
  • Universal reference gene
NA
  • F:CGTTGCTCACTACGAGTTCAC
  • R:CGTTGCTCACTACGAGTTCAC
178 62.1 SYBR
PGK[1] Phosphoglycerate kinase
  • Universal reference gene
NA
  • F:ATACCTAATGGACGAAGAGA
  • R:ATACCTAATGGACGAAGAGA
248 64.1 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Silan Dai
  • Email: silandai@sina.com
  • Institution: College of Landscape Architecture, Beijing Forestry University, Beijing, China

Citation Statistics

Cited by 0 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 Hu P, Niu J, Yu M, Lin S-Y (2017) Facile Solvothermal Synthesis of Reduced Graphene Oxide-BiPO 4 Nanocomposite with Enhanced Photocatalytic Activity. Chinese Journal of Analytical Chemistry 45, 357-362.
  2. Qi S, Yang L, Wen X, et al. (2016) Reference Gene Selection for RT-qPCR Analysis of Flower Development in Chrysanthemum morifolium and Chrysanthemum lavandulifolium. Front Plant Sci 7, 287.