Chrysanthemum morifolium

From ICG
Jump to navigation Jump to search

Description

REFqPCR2016017-1.jpg
  • Chrysanthemum (Chrysanthemum × morifolium Ramat.), one of the 10 most well-known Chinese traditional flowers, is composed of the most abundant and various cultivars among the horticultural plants around the world. The petal types of chrysanthemums were classified into five groups containing flat, tubular, spoon, abnormal, and anemone. The diversity of the flower shape is determined by the numbers of the two types of florets and the variation of petal types.
  • Chrysanthemum morifolium cv. (Chuju) is the China national geographical indication product, and also is one of characteristic of plant resources in Anhui province. Currently, Chuju has been approved as pharmaceutical/food resource by the Ministry of Health of China as it contains flavonoids, polysaccharides, polyphenols and other substances. The cultivation of Chuju in China has lasted about two thousand years. However, in recent years, the continuous cropping obstacle phenomenon has became a bottleneck restricting factor in development of Chuju industry. [1] [2].

Flower Development

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
SAND[1] SAND family protein
  • Universal reference gene
NA
  • F:CGTTGCTCACTACGAGTTCAC
  • R:CGTTGCTCACTACGAGTTCAC
178 62.1 SYBR
PGK[1] Phosphoglycerate kinase
  • Universal reference gene
NA
  • F:ATACCTAATGGACGAAGAGA
  • R:ATACCTAATGGACGAAGAGA
248 64.1 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Silan Dai
  • Email: silandai@sina.com
  • Institution: College of Landscape Architecture, Beijing Forestry University, Beijing, China

Citation Statistics

Cited by 4 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 Hu P, Niu J, Yu M, Lin S-Y (2017) Facile Solvothermal Synthesis of Reduced Graphene Oxide-BiPO 4 Nanocomposite with Enhanced Photocatalytic Activity. Chinese Journal of Analytical Chemistry 45, 357-362.
  2. Qi S, Yang L, Wen X, et al. (2016) Reference Gene Selection for RT-qPCR Analysis of Flower Development in Chrysanthemum morifolium and Chrysanthemum lavandulifolium. Front Plant Sci 7, 287.