Difference between revisions of "Cicer arietinum"

From ICG
Jump to navigation Jump to search
Line 78: Line 78:
 
*'''Email''': p.bhatnagar@cgiar.org
 
*'''Email''': p.bhatnagar@cgiar.org
 
*'''Institution''': Genetic Transformation Laboratory, International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru-502324, Telangana, India
 
*'''Institution''': Genetic Transformation Laboratory, International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru-502324, Telangana, India
 +
 +
==Citation Statistics==
 +
Cited by '''0''' (Based on Google Scholar [2017-06-01])
  
 
=='''References'''==
 
=='''References'''==
Line 91: Line 94:
 
</ref>
 
</ref>
 
</references>
 
</references>
 +
 +
[[Category:Plants]]

Revision as of 09:55, 16 June 2017

Description

REFqPCR2016014-1.JPG
  • Chickpea is an important food legume of the semi-arid tropical (SAT) regions of the world, known to be a nutraceutical (or health benefiting food) because of its high nutritional value. Despite growing demand and high yield potential, chickpea yield is unstable and productivity is stagnant at unacceptably low levels due to constraints such as abiotic stresses (drought, heat, cold and high-salinity) and biotic stresses (Ascochyta blight, Fusarium wilt and pod borer).
  • chickpeas germinated in presence of sodium metavanadate increased 32% and 11% the formononetin and biochanin A contents, respectively. Also a combination of sodium chloride and sodium sulfate, used during chickpea soaking before 4 germination days, increased the concentration of ononin, daidzein and biochanin A glucoside by 71%, 11% and 13%, respectively, compared with the germinated control. [1] [2] [3].

Across Cultivated and Wild Species

Reference Genes

Gene Symbol Gene Name Application Scope Accession Number Primer Size [bp] Tm [℃] Detection
UCP[1] Uncharacterized conserved protein
  • Across different genotypes
XM_004505295
  • F:TGGAGCCCAATTACAAAAGC
  • R:TGGAGCCCAATTACAAAAGC
138 62 SYBR
G6PD[1] Glucose-6-phosphate 1-dehydrogenase
  • Across different genotypes
XM_004515773
  • F:ACAACGATACCAGGGTGTTACC
  • R:ACAACGATACCAGGGTGTTACC
116 62 SYBR
TIP41[1] Tonoplast intrinsic proteins -like protein
  • Abiotic stress conditions
XM_004496854
  • F:GTTGTACTTCGGGAGAGTTGCT
  • R:GTTGTACTTCGGGAGAGTTGCT
115 62 SYBR
ABCT[1] ATP-binding cassette transporter
  • Universal reference gene
XM_004505589
  • F:TCACAGGTTGTGATGGAGTCTG
  • R:TCACAGGTTGTGATGGAGTCTG
135 62 SYBR

Moleculer Types

  • mRNA

Evaluation Methods

Contact

  • Name: Pooja Bhatnagar-Mathur
  • Email: p.bhatnagar@cgiar.org
  • Institution: Genetic Transformation Laboratory, International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru-502324, Telangana, India

Citation Statistics

Cited by 0 (Based on Google Scholar [2017-06-01])

References

  1. 1.0 1.1 1.2 1.3 1.4 Guardado-Felix D, Serna-Saldivar SO, Cuevas-Rodriguez EO, Jacobo-Velazquez DA, Gutierrez-Uribe JA (2017) Effect of sodium selenite on isoflavonoid contents and antioxidant capacity of chickpea (Cicer arietinum L.) sprouts. Food Chem 226, 69-74.
  2. Jogihalli P, Singh L, Sharanagat VS (2017) Effect of microwave roasting parameters on functional and antioxidant properties of chickpea (Cicer arietinum). LWT - Food Science and Technology 79, 223-233.
  3. Reddy DS, Bhatnagar-Mathur P, Reddy PS, et al. (2016) Identification and Validation of Reference Genes and Their Impact on Normalized Gene Expression Studies across Cultivated and Wild Cicer Species. PLoS One 11, e0148451.